Next Article in Journal
MaAzaR, a Zn2Cys6/Fungus-Specific Transcriptional Factor, Is Involved in Stress Tolerance and Conidiation Pattern Shift in Metarhizium acridum
Previous Article in Journal
Preliminary Bioactivity Assessment of Myrothecium Species (Stachybotryaceae) Crude Extracts against Aedes aegypti (Diptera: Culicidae): A First Approach from This Phytopathogenic Fungi
 
 
Journals
JoF
Volume 10
Issue 7
10.3390/jof10070467
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Didymella segeticola Causing Tea Leaf Spot

by
Yiyi Tu
1,†,
Yuchun Wang
1,2,†,
Hong Jiang
1,
Hengze Ren
1,
Xinchao Wang
1,2,* and
Wuyun Lv
1,2,*
1
College of Tea Science and Tea Culture, Zhejiang A&F University, Hangzhou 311300, China
2
Tea Research Institute, Chinese Academy of Agricultural Sciences/National Center for Tea Improvement/Key Laboratory of Biology, Genetics and breeding of Special Economic Animals and Plants, Ministry of Agriculture and Rural Affairs, Hangzhou 310008, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
J. Fungi 2024, 10(7), 467; https://doi.org/10.3390/jof10070467
Submission received: 3 June 2024 / Revised: 1 July 2024 / Accepted: 2 July 2024 / Published: 3 July 2024
Browse Figures
Versions Notes

Abstract

:
Tea leaf spot caused by Didymella segeticola is an important disease that threatens the healthy growth of tea plants (Camellia sinensis) and results in reductions in the productivity and quality of tea leaves. Early diagnosis of the disease is particularly important for managing the infection. Loop-mediated isothermal amplification (LAMP) assay is an efficient diagnostic technique with the advantages of simplicity, specificity, and sensitivity. In this study, we developed a rapid, visual, and high-sensitivity LAMP assay for D. segeticola detection based on sequence-characterized amplified regions. Two pairs of amplification primers (external primers F3 and B3 and internal primers FIP and BIP) were designed based on a specific sequence in D. segeticola (NCBI accession number: OR987684). Compared to common pathogens of other genera in tea plants and other species in the Didymella genus (Didymella coffeae-arabicae, Didymella pomorum, and Didymella sinensis), the LAMP method is specific for detecting the species D. segeticola. The assay was able to detect D. segeticola at a minimal concentration of 1 fg/μL genomic DNA at an optimal reaction temperature of 65 °C for 60 min. When healthy leaves were inoculated with D. segeticola in the laboratory, the LAMP method successfully detected D. segeticola in diseased tea leaves at 72 h post inoculation. The LAMP assays were negative when the DNA samples were extracted from healthy leaves. Leaf tissues with necrotic lesions from 18 germplasms of tea plants tested positive for the pathogen by the LAMP assay. In summary, this study established a specific, sensitive, and simple LAMP method to detect D. segeticola, which provides reliable technical support for estimating disease prevalence and facilitates sustainable management of tea leaf spot.

1. Introduction

Tea plant [Camellia sinensis (L.) O. Kuntze] is a perennial woody species that is widely cultivated in tropical and subtropical areas such as China, India, Sri Lanka, Kenya, and Japan [1,2,3]. Tea plants often suffer from various diseases caused by pathogenic fungi, which threaten global tea production [2,4,5,6,7]. Zhao et al. (2018) reported that tea leaf spot disease caused by Didymella segeticola (Q. Chen) Q. Chen, Crous & L. Cai severely affects the quality and yield of tea leaves [8]. D. segeticola invades young leaves or mature leaves, resulting in small needle-like brown spots surrounded by a yellow halo at the early stage of infection; the lesions gradually expand and fuse into irregular spots, and the center becomes grayish-brown to grayish-white; diseased leaves are deformed and twisted, easily fall off, and grow slowly in the later stage of infection [8,9]. Leaf spots have become common foliar diseases of tea plants in recent years, resulting in a decrease in tea productivity and affecting quality and flavor by changing the composition and content of key secondary metabolites [8,9,10]. Early detection and subsequent development of strategies to manage this disease are therefore urgently needed and crucially important [11].
Traditionally, disease diagnosis involving the isolation, identification, and characterization of pathogens is strenuous, time-consuming, and microscopy-dependent [12,13]. Recently, molecular diagnostic methods based on some conserved housekeeping sequences, such as ribosomal RNA-encoding DNA sequences, the glyceraldehyde-3-phosphate dehydrogenase-encoding gene, and cytoskeletal protein-encoding genes, have been used for the identification of pathogens that are difficult to distinguish morphologically [11,14,15,16,17]. On this basis, polymerase chain reaction (PCR) has been routinely used for disease diagnosis and detection of a large range of plant pathogenic fungi [18]. Real-time PCR (quantitative PCR, qPCR), reverse transcription PCR, nested PCR, and droplet digital PCR have further been developed as new DNA-based molecular diagnostic tools [18,19,20,21,22]. In addition, terminal restriction fragment length polymorphism (T-RFLP), immunological methods, DNA microarray, denaturing gel gradient electrophoresis, and next-generation sequencing platforms are also applied to identifying pathogens [18,23,24,25]. However, these technologies have common limitations, such as complex experimental designs, costly consumables, consumed time, trained manpower, and specific apparatuses, even though they can specifically identify pathogens [11]. Thus, many isothermal nucleic acid amplification techniques have been developed and applied for disease diagnosis because they do not require specific apparatuses, such as thermocyclers, electrophoresis devices, and UV light [22]. These techniques mainly include cross-priming amplification (CPA), helicase-dependent amplification (HDA), loop-mediated isothermal amplification (LAMP), nucleic acid sequence-based amplification (NASBA), polymerase spiral reaction (PSR), strand-displacement amplification (SDA), rolling circle amplification (RCA), and recombinase polymerase amplification (RPA) [22,26,27,28,29,30,31,32].
LAMP is an efficient and powerful technique that can be used for the molecular detection of plant pathogenic fungi in disease diagnosis [33,34,35,36,37]. Conventionally, at least four specific primers, including two external primers (F3 and B3) and two internal primers (forward inner primer, FIP, and backward inner primer, BIP), are needed to recognize six different regions in the target DNA with a strand-displacing DNA polymerase under isothermal conditions [22,30]. The LAMP reaction was carried out at 60–65 °C within a short reaction time (<1 h), eliminating the dependence on a thermocycler [38]. With low instrument requirements, it can be performed in a water bath or heating block [30,39]. LAMP is thus simple, rapid, specific, highly sensitive, and efficient [34]. Furthermore, the LAMP product can be easily visualized by adding magnesium titration with hydroxy naphthol blue, a pH-sensitive dye, and fluorescent compounds such as SYBR Green I, calcein, EvaGreen, SYTO, and berberine [40,41,42,43]. With these advantages, the LAMP method has been widely used for the detection of many plant-pathogenic fungi [44,45,46,47,48,49]. For example, the LAMP assay is a useful and convenient method for directly detecting Colletotrichum truncatum in diseased soybean tissues [49]. A set of four primers exhibiting high species specificity and sensitivity that target the Rpb1 (encoding the large subunit of RNA polymerase II) sequence of C. truncatum was selected for further study. After amplification at 62 °C for 70 min, the LAMP products turned yellow-green in the presence of C. truncatum when SYBR Green I was added. The sensitivity of the LAMP assay was determined, and the results showed that the minimum concentration of C. truncatum DNA detected in the assay was 100 pg μL−1 [49]. For pathogenic fungi isolated from tea plants, the LAMP assay has been used for the rapid and precise detection of C. siamense and Exobasidium vexans [50,51]. However, a LAMP method has not yet been developed for the detection of D. segeticola, which is the causal agent of tea leaf spot.
In this study, we developed a rapid, visual, sensitive, and precise LAMP assay for the detection of D. segeticola identified from tea plants in Jiangsu, Yunnan, and Zhejiang Provinces in China based on sequence-characterized amplified regions. Two pairs of species-specific amplification primers (external primers F3 and B3 and internal primers FIP and BIP) targeting a specific sequence of D. segeticola were designed and screened. The specificity, sensitivity, and efficiency of the LAMP assay were determined, and disease diagnosis in the field was also performed. We demonstrated that the LAMP method can be used as a field-portable diagnostic assay with the advantages of simplicity, effectiveness, and visibility. The application of LAMP detection in field prediction and monitoring of tea leaf spot disease can lead to timely intervention in disease outbreaks and provide an important approach for developing sustainable strategies for the management of tea leaf spot.

2. Materials and Methods

2.1. Strains

A total of eight isolates of Didymella segeticola were collected from tea plant leaves, including YCW109 and YCW1111 from Jiangsu Province; YCW205 and YCW2007 from Yunnan Province; and YCW192, YCW1135, YCW1289, and YCW2184 from Zhejiang Province (Table 1). Colletotrichum camelliae LS_19, D. coffeae-arabicae YCW1972, D. pomorum YCW196, D. sinensis YCW1906 and YCW1950, and Stagonosporopsis caricae YCW1928 were used as controls in this study [52,53,54,55]. Six isolates of D. segeticola YCW192, YCW205, YCW1111, YCW1135, YCW1289, and YCW2184, and C. camelliae LS_19 were obtained from diseased leaves via single-spore isolation [52,54,55]. Didymella coffeae-arabicae YCW1972, D. pomorum YCW196, D. sinensis YCW1906 and YCW1950, and S. caricae YCW1928 were obtained by tissue isolation from healthy leaves. All the strains used in this study were identified based on morphological characteristics and multi-locus phylogenetic analysis [56]. The sequences of the ITS (the internal transcribed spacer region of the rDNA gene), LSU (partial large subunit nrDNA nucleotide sequences), RPB2 (the RNA polymerase II second largest subunit gene), and TUB2 (partial gene regions of β-tubulin) loci used for identification of the isolates can be obtained from GenBank® (https://www.ncbi.nlm.nih.gov/genbank/, accessed on 20 May 2023) with accession numbers as listed in Table 1.

2.2. Culture Conditions and DNA Extraction

Isolates were cultured on potato dextrose agar (PDA) at 28 °C in the dark for 7 days. Aerial mycelia of each isolate were scraped from the plates and then subjected to DNA extraction. Genomic DNA was extracted from the collected mycelia using a Genomic DNA Purification Kit (Product number: B518259-0100, Sangon Biotechnology (Shanghai) Co., Ltd., Shanghai, China). DNA concentrations were determined spectrophotometrically using 260-nm absorbance with an ultra-micro ultraviolet-visible spectrophotometer ND-100C (MIULAB, Hangzhou, China) [49]. All DNA samples dissolved in sterile ddH2O were stored in DNase-free and sterile 1.5 mL centrifuge tubes at −20 °C.

2.3. LAMP Primer Design

The genome sequences of D. segeticola (GenBank accession number: GCA_004522025.1) and the dominant pathogenic fungi in tea plants (C. camelliae: GenBank accession number GCA_018853505.1; C. fructicola: GenBank accession number GCA_025558505.1; and Pseudopestalotiopsis camelliae-sinensis: unpublished) were obtained from the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov, accessed on 27 September 2022) with accession numbers or from the assembly of the Illumina HiSeq PE150 platform (Beijing Novogene Bioinformatics Technology Co., Ltd., Beijing, China). BLAST analysis was used to explore DNA sequences which were exclusively present in the D. segeticola genome [57]. After repeated experiments, a species-specific DNA sequence (NCBI accession number: OR987684), which was predicted to encode a Cys2His2-zinc-finger (C2H2-ZNF) protein, was selected as the target sequence. Primer Explorer V5 (online web service, http://primerexplorer.jp/e/, accessed on 1 June 2023) was used for the design of the LAMP primers. The four LAMP primers used are listed in Table 2 and included two external primers (F3 and B3) and two internal primers (FIP and BIP). The primers used were synthesized by SUNYA Biotechnology Co., Ltd. (Hangzhou, China). The specificity and sensitivity of the LAMP primers were tested. For the specificity test, the DNA concentration was uniformly diluted to 10 ng/µL. To evaluate the sensitivity of the LAMP assays, the DNA extracted from three isolates of D. segeticola (YCW109, YCW1135, and YCW1289) was serially diluted 10-fold (from 10 ng/µL to 10 ag/µL) as a template for the experiment.

2.4. Optimization of LAMP Reaction Conditions

The LAMP reactions were performed in a 25 μL reaction mixture consisting of 2.5 µL of 10 × ThermoPol Buffer (Somersworth, NH, USA), 1.5 µL of 100 mM MgSO4, 3.5 µL of 10 mM dNTP mixture, 4 µL of 10 mM external primers (F3 and B3), 0.5 µL of 10 mM internal primers (FIP and BIP), 1 µL of Bst DNA Polymerase, Large Fragment (Nanjing Vazyme Biotech Co., Ltd., Nanjing, China), and 1 µL of DNA template, adjusted to a final volume of 25 μL with sterilized distillation-distillation H2O (ddH2O). To determine the optimal temperature and time of the LAMP reactions, the LAMP mixtures were incubated for 60 min at 55, 58, 60, 62, 65, 68, and 70 °C, and at 65 °C in a water bath for 15, 30, 45, 60, 75, and 90 min [34,35,37]. The reactions were terminated by heat inactivation at 95 °C for 2 min. Each product was confirmed by 2.0% agarose gel electrophoresis and photographed under a UV transilluminator. In addition, after the reactions, the LAMP products were directly observed by the unaided eye after the addition of 0.2 µL of SYBR Green I dye (10,000 × concentrate in DMSO, Coolaber, Beijing, China). With a positive reaction, the mixture was yellow-green in color, whereas with a negative reaction, the color of the mixture remained orange. The experiments were repeated three times.

2.5. Detection of D. segeticola in Tea Plant Leaves

Healthy leaves were collected from 5-year-old tea plants of Camellia sinensis cv. Longjing43 (LJ43), cv. Zhongcha102 (ZC102), cv. Zhongcha108 (ZC108), and cv. Zhongcha302 (ZC302). Then, the leaves were surface-sterilized with 75% alcohol and washed with sterilized ddH2O twice. Tea plant leaves were air dried and subsequently inoculated with mycelial discs of D. segeticola isolates via the wound inoculation method [58]. A 5-mm mycelial disc from D. segeticola was placed on the wound on both sides of the main vein (left and right sides) and cultured for 48 h at 25 °C during the day and 20 °C at night, with cycles of 14 h of light and 10 h of darkness and a relative humidity of 80% [58]. Leaves of LJ43 inoculated with sterilized ddH2O were treated as the negative control. Each treatment with three biological replicates was repeated three times. After 3 days, genomic DNA was extracted from diseased leaves using a Genomic DNA Purification Kit (Sangon Biotechnology (Shanghai) Co., Ltd., Shanghai, China) according to the manufacturer’s protocol. The same method was used to extract genomic DNA from healthy leaves as the negative control. The LAMP assay was used to detect the presence or absence of D. segeticola in tea plant leaves.

2.6. Detection of D. segeticola in Leaves from Fields

Healthy and diseased leaves from 18 germplasms of tea plants, named 2018-M89, 2018-M90, 2018-M95, 2018-M86, 2018-M100, 2021-WZ-7, AJ15, AJ16, AJ17, AJ18, 2021-20M, 2021-38M, 2021-19M, 2021-45M, 2021-2-2-M, 2021-01-M, 2021-2-6-M, and 2021-3-11-M, were collected from the tea garden of the Tea Research Institute, Chinese Academy of Agricultural Sciences. Healthy leaves were collected on 15 June 2023, and diseased leaves were collected on 7 August 2023. Genomic DNA was extracted from the leaves using the same method as above, and then subjected to LAMP assays. Diseased leaves of LJ43 inoculated with the D. segeticola strain YCW2184 in the laboratory were treated as the positive control. At least three replicates of each treatment were repeated at least two times.

3. Results

3.1. Specificity of the LAMP Assay

We first determined the specificity of LAMP assays with genomic DNA from Didymella segeticola and other fungi, Colletotrichum camelliae, D. coffeae-arabicae, D. pomorum, D. sinensis, and Stagonosporopsis caricae, which were isolated from tea plant leaves. Only samples from D. segeticola, which were isolated from tea plants in different areas, exhibited a ladder-like pattern in a 2% agarose gel after the reaction (Figure 1A). After the addition of SYBR Green I, the reaction products containing D. segeticola became yellowish-green (Figure 1B). In contrast, samples extracted from other fungi showed negative reactions. The results suggested that the LAMP assay can specifically detect D. segeticola.

3.2. Optimization of the LAMP Reaction Conditions

To optimize the LAMP reaction conditions, we carried out repeated assays using the genomic DNA of two D. segeticola isolates, YCW109 and YCW1289, as templates to determine the appropriate temperature and reaction time. A series of temperatures (55, 58, 60, 62, 65, 68, 70 °C) and durations (15, 30, 45, 60, 75, 90 min) were used for the LAMP assays according to previous methods. Ladder-like DNA fragments and discernible color changes were clearly observed in samples from both D. segeticola isolates heated at 60 °C to 68 °C for 60 min (Figure 2A). Similarly, positive reactions were clearly observed after 45–90 min of incubation at 65 °C. In addition, the ladder-like band was most clear at 65 °C and became more obvious after 60 min (Figure 2B). No ladder-like banding patterns with color changes were observed in the ddH2O control or other conditions. Thus, the LAMP assay applied for detecting D. segeticola was determined under the optimal conditions of 65 °C for 60 min.

3.3. Sensitivity of the LAMP Assays

The sensitivity of the LAMP assay was accessed via amplification with 10-fold serial dilutions (from 10 ng/µL to 10 ag/µL) of genomic DNA extracted from three isolates of D. segeticola YCW109, YCW1135, and YCW1289 as templates. After reacting at 65 °C for 60 min, agarose gel electrophoresis clearly revealed ladder-like patterns at a minimal concentration of 1 fg/μL genomic DNA from the three isolates of D. segeticola (Figure 3A). After adding SYBR Green I to the reaction products, the products became yellowish-green (Figure 3B). No ladder-like banding patterns with color changes were observed in the ddH2O control or at the concentration of 100 ag/μL and 10 ag/μL genomic DNA from the three isolates. The minimum concentration of D. segeticola DNA detected for the LAMP assay was 1 fg/µL.

3.4. Using the LAMP Assay to Detect D. segeticola in Inoculated Tea Leaves

After determining the specificity, reaction conditions, and sensitivity of the LAMP assay, we subsequently performed the assay to detect D. segeticola in tea leaves. First, we inoculated the healthy tea leaves of LJ43, ZC102, ZC108, and ZC302 with D. segeticola isolates, respectively, via the wound-inoculation method (Figure 4A). After inoculation for 48 h, necrotic lesions were observed on mostly detached tea leaves. Then, total genomic DNA was extracted from diseased leaves and tested by a LAMP assay and evaluated by agarose gel electrophoresis and color changes with the addition of SYBR Green I. Although the aggressiveness of the isolates of D. segeticola varied, the reactions of all the inoculated samples were positive (Figure 4B). These results indicated that the LAMP assay can detect D. segeticola on the leaves of different tea plant cultivars.

3.5. Using the LAMP Assay to Detect D. segeticola in the Field

To further validate the usefulness of the LAMP assay, we used it to detect D. segeticola in healthy or diseased leaves of 18 germplasms of tea plants collected from the tea garden at the Tea Research Institute, Zhejiang Province. Total genomic DNA extracted from healthy or diseased tea leaves of the cultivars was used as the template for the LAMP assay. Health leaf samples tested negative for D. segeticola by the LAMP assay (Figure 5). Leaf samples with necrotic lesions from 18 germplasms of tea plants tested positive for D. segeticola in the LAMP assay (Figure 6). Therefore, the LAMP assay can be deployed in the field to rapidly detect D. segeticola in infected leaves.

4. Discussion

Didymella segeticola was first reported to cause leaf spot on the Tibetan thistle [59], and Zhao et al. (2018) reported that D. segeticola can cause wide occurrence of tea leaf spot in tea plantations in Guizhou Province [8]. Deng et al. (2023) reported that D. segeticola was the main pathogen causing leaf spot disease in commercial tea plantations in Guizhou and Sichuan Provinces [9]. Foliar disease on tea plants tends to occur during cold spell periods in tea plantations at higher altitudes or late spring, so it occurs mainly in southwestern China [8,58,60]. In other tea plantations, D. segeticola could also be isolated from infected tea leaves displaying leaf spots [61], implying that tea leaf spot caused by D. segeticola may spread gradually in the main tea cultivation provinces in China. However, as the most damaging and common foliar disease of tea plants, the epidemic of leaf spot has not been reported, and thus this disease can be difficult to control [9]. Thus, early diagnosis and rapid detection are highly important for limiting the spread of tea leaf spot in tea fields.
In this study, the LAMP assay was developed as a credible and sensitive diagnostic method for the detection of D. segeticola isolates from pure cultures as well as from infected samples in tea fields. To ensure the specificity of the LAMP assay for the detection of D. segeticola, we performed comparative genomic analysis using the genome sequences of the main pathogens identified from tea plants, including Colletotrichum camelliae, C. fructicola, D. segeticola, and Pseudopestalotiopsis camelliae-sinensis (we have assembled but cannot provide the genome information currently available). Many species-specific sequences were obtained and used to design the LAMP primers. After many attempts, we eventually identified a specific sequence as an appropriate and highly specific target for the design of LAMP primers. Based on BLASTN analysis, the sequence was predicted to encode a C2H2-ZNF protein. However, the biological functions of the protein have not been confirmed, so we submitted the sequence data to GenBank as a nucleotide sequence encoding a hypothetical protein (accession number: OR987684).
The LAMP technique involves loop insertions and strand displacement to perform entirely isothermal amplification, which requires at least four primers [22]. Two inner primers (FIP and BIP) invert sequences attached at their 5′ ends of F2/B2 regions and are used for strand displacement DNA synthesis [22,37,62]. Two outer primers (F3 and B3) anneal upstream of the inner primers, acting as binding sites for the Bst DNA polymerase, which has high displacement activity, and is used in the initial steps of the LAMP reactions [22,30,37,62]. In addition, two loop primers (forward loop F and backward loop B) can be used to achieve exponential amplification of LAMP and thus accelerate the reactions and improve the LAMP efficiency [37,62,63,64]. Studies have revealed that the time required for amplification with two loop primers is one-third to one-half of that required without a loop primer, and amplification can be achieved within 30 min [64]. In the process of primer screening, we also designed loop primers for LAMP detection in addition to inner and outer primers. However, the addition of loop primers results in difficulty in efficient amplification; therefore, we used four primers for the LAMP assays to ensure efficiency in this study. Similarly, numerous studies have chosen four primers to detect various plant pathogens via LAMP assays [35,37,65,66,67].
Based on the LAMP primer set designed for the amplification of target DNA sequences [68,69], we detected D. segeticola in different types of samples, including tea leaves infected with D. segeticola, healthy leaves, and suspected samples showing symptoms of leaf spots in the field. The LAMP reactions of samples from diseased tea leaves with suspected early symptoms were positive (Figure 4 and Figure 6), but the reactions of samples from healthy tea leaves were negative (Figure 5). The results confirmed that the LAMP assay could be used to directly detect D. segeticola in diseased samples from tea plants. Surprisingly, when tea leaf spots were severe, ladder-like DNA fragments and color changes were observed via the LAMP assay for the detection of D. segeticola in the young tea leaves without symptoms (Figure S1), which further suggested that the LAMP assay could be an efficient and sensitive method for the early diagnosis of leaf spots. In addition, the results of the sensitivity of the LAMP assays showed that reactions with 1 fg/µL D. segeticola genomic DNA as the template were still positive (Figure 3), indicating that the LAMP detection performed in this study was indeed highly sensitive.
The optimal conditions for the LAMP reaction for the detection of D. segeticola were at 65 °C for 60 min in a regular water bath, which provides isothermal conditions (Figure 2); this approach greatly reduced equipment requirements, and saved time and cost. However, LAMP has been used to develop a toolkit for detecting wheat blast caused by Pyricularia oryzae, which can provide results within 8 min as a quick pre-screening test [70,71]. Therefore, the LAMP assay in this study can be further optimized and improved in subsequent studies to more sensitively and efficiently detect D. segeticola from various samples in a shorter time. The genomic DNA used in the LAMP assay was extracted by an elaborate Genomic DNA Purification Kit at a price, which increases the procedure and cost of LAMP detection. Thus, the utilization of LAMP assays in fields can incorporate a quick and easy method for DNA extractions.

5. Conclusions

This is the first report describing a LAMP assay for the specific detection of D. segeticola in diseased tea leaves. Compared with other PCR detection methods, the developed LAMP assay, which has high operability, specificity, and sensitivity, is appropriate for the detection of D. segeticola and early diagnosis of tea leaf spot.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jof10070467/s1, Figure S1: LAMP assay for detecting Didymella segeticola in the young tea leaves without symptoms. Tea plants of LJ43 and ZC108 were respectively inoculated with the D. segeticola strain YCW2184. After about 20 days, the apical buds, first leaves and second leaves without symptoms of inoculated LJ43 and ZC108 were collected and prepared for the genomic DNAs extraction. Agarose gel electrophoresis and color changes showing the LAMP results. Lane 1: apical buds of LJ43; Lane 2: first leaves of LJ43; Lane 3: second leaves of LJ43; Lane 4: apical buds of ZC108; Lane 5: first leaves of ZC108; Lane 6: second leaves of ZC108. M, DL5000 DNA marker.

Author Contributions

Conceptualization, Y.W., X.W. and W.L.; methodology, validation, investigation, and formal analysis, Y.W., H.J. and Y.T.; software, Y.T.; resources, Y.W.; data curation, W.L. and Y.W.; writing-original draft preparation, W.L., Y.T. and Y.W.; writing-review and editing, Y.W., X.W., W.L. and H.R.; funding acquisition, Y.W. All authors have read and agreed to the published version of the manuscript.

Funding

The research was financially supported by the Zhejiang University Student Science and Technology Innovation Activity Plant (New Seedling Talent Plant Subsidy Project, 2024R412B052); the Chinese Academy of Agricultural Sciences through an Innovation Project for Agricultural Sciences and Technology (CAAS-ASTIP-2021-TRICAAS); Zhejiang Science and Technology Major Program on Agricultural New Variety Breeding—Tea Plant (2021C02067-7); the Scientific Research Project of Zhejiang Education Department (Y202250195); the Fundamental Research Funds for the Provincial Universities of Zhejiang (2020YQ001); the Zhejiang Provincial Natural Science Foundation (LY22C160001); and the Scientific Research and Development Foundation of Zhejiang A&F University (2024LFR018).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no competing financial interests.

References

  1. Hao, X.; Zhang, W.; Zhao, F.; Liu, Y.; Qian, W.; Wang, Y.; Zeng, J.; Yang, Y.; Wang, X. Discovery of plant viruses from tea plant (Camellia sinensis (L.) O. Kuntze) by metagenomic sequencing. Front. Microbiol. 2018, 9, 2175. [Google Scholar] [CrossRef] [PubMed]
  2. Manawasinghe, I.S.; Jayawardena, R.S.; Li, H.L.; Zhou, Y.Y.; Zhang, W.; Phillips, A.J.L.; Wanasinghe, D.N.; Dissanayake, A.J.; Li, X.H.; Li, Y.H.; et al. Microfungi associated with Camellia sinensis: A case study of leaf and shoot necrosis on tea in Fujian, China. Mycosphere 2021, 12, 430–518. [Google Scholar] [CrossRef]
  3. Tan, X.; Xie, H.; Yu, J.; Wang, Y.; Xu, J.; Xu, P.; Ma, B. Host genetic determinants drive compartment-specific assembly of tea plant microbiomes. Plant Biotechnol. J. 2022, 20, 2174–2186. [Google Scholar] [CrossRef] [PubMed]
  4. Kong, L.; Chen, J.; Dong, K.; Shafik, K.; Xu, W. Genomic analysis of Colletotrichum camelliae responsible for tea brown blight disease. BMC Genom. 2023, 24, 528. [Google Scholar] [CrossRef]
  5. Kumhar, K.C.; Babu, A.; Nisha, S.N. Management of tea (Camellia sinensis) diseases with application of microbes: A review. Innovare J. Agric. Sci. 2022, 10, 6–10. [Google Scholar]
  6. Orrock, J.M.; Rathinasabapathi, B.; Richter, B.S. Anthracnose in U. S. tea: Pathogen characterization and susceptibility among tea accessions. Plant Dis. 2020, 104, 1055–1059. [Google Scholar] [CrossRef] [PubMed]
  7. Zheng, S.; Chen, R.; Wang, Z.; Liu, J.; Cai, Y.; Peng, M.; Zhang, T.; Li, Y.; Wang, B.; Bao, J.; et al. High-quality genome assembly pf Pseudopestalotiopsis theae, the pathogenic fungus causing tea gray blight. Plant Dis. 2021, 105, 3723–3726. [Google Scholar] [CrossRef] [PubMed]
  8. Zhao, X.; Wang, Y.; Li, D.; Ren, Y.; Chen, Z. Morphological characterization and phylogenetic analysis of the pathogen Phoma segeticola var. camelliae causing a new tea disease. Acta Phytopathol. Sin. 2018, 48, 556–559. [Google Scholar]
  9. Deng, X.; Yang, J.; Wan, Y.; Han, Y.; Tong, H.; Chen, Y. Characteristics of leaf spot disease caused by Didymella species and the influence of infection on tea quality. Phytopathology 2023, 113, 516–527. [Google Scholar] [CrossRef] [PubMed]
  10. Ren, Y.; Li, D.; Zhao, X.; Wang, Y.; Bao, X.; Wang, X.; Wu, X.; Wang, D.; Song, B.; Chen, Z. Whole genome sequences of the tea leaf spot pathogen Didymella segeticola. Phytopathology 2019, 109, 1676–1678. [Google Scholar] [CrossRef]
  11. Mansotra, R.; Vakhlu, J. Comprehensive account of present techniques for in-field plant disease diagnosis. Arch. Microbiol. 2021, 203, 5309–5320. [Google Scholar] [CrossRef] [PubMed]
  12. Li, Q.; Zhu, J.; Ren, N.; Li, D.; Jin, Y.; Lu, W.; Lu, Q. Characteristics and pathogenicity of Discula theae-sinensis isolated from tea plant (Camellia sinensis) and interaction with Colletotrichum spp. Plants 2023, 12, 3427. [Google Scholar] [CrossRef] [PubMed]
  13. Patel, R.; Mitra, B.; Vinchurkar, M.; Adami, A.; Patkar, R.; Giacomozzi, F.; Lorenzelli, L.; Baghini, M.S. Plant pathogenicity and associated/related detection systems. A review. Talanta 2023, 251, 123808. [Google Scholar] [CrossRef] [PubMed]
  14. Jayawardena, R.S.; Zhang, W.; Liu, M.; Maharachchikumbura, S.S.; Zhou, Y.; Huang, J.; Nilthong, S.; Wang, Z.; Li, X.; Yan, J.; et al. Identification and characterization of Pestalotiopsis-like fungi related to grapevine diseases in China. Fungal Biol. 2015, 119, 348–361. [Google Scholar] [CrossRef] [PubMed]
  15. Liu, F.; Ma, Z.Y.; Hou, L.W.; Diao, Y.Z.; Wu, W.P.; Damm, U.; Song, S.; Cai, L. Updating species diversity of Colletotrichum, with a phylogenomic overview. Stud. Mycol. 2022, 101, 1–56. [Google Scholar] [CrossRef] [PubMed]
  16. Weir, B.S.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef] [PubMed]
  17. Zhao, P.; Crous, P.W.; Hou, L.W.; Duan, W.J.; Cai, L.; Ma, Z.Y.; Liu, F. Fungi of quarantine concern for China I: Dothideomycetes. Persoonia 2021, 47, 45–105. [Google Scholar] [CrossRef] [PubMed]
  18. McCartney, H.A.; Foster, S.J.; Fraaije, B.A.; Ward, E. Molecular diagnostics for fungal plant pathogens. Pest Manag. Sci. 2003, 59, 129–142. [Google Scholar] [CrossRef] [PubMed]
  19. Chung, P.C.; Wu, H.Y.; Chen, Y.C.; Hung, T.H.; Chung, C.L. Development of a nested PCR assay for detecting Colletotrichum siamense and Colletotrichum fructicola on symptomless strawberry plants. PLoS ONE 2022, 17, e0270687. [Google Scholar] [CrossRef]
  20. Du, Y.; Wang, M.; Zou, L.; Long, M.; Yang, Y.; Zhang, Y.; Liang, X. Quantitative detection and monitoring of Colletotrichum siamense in rubber trees using real-time PCR. Plant Dis. 2021, 105, 2861–2866. [Google Scholar] [CrossRef]
  21. Hindson, B.J.; Ness, K.D.; Masquelier, D.A.; Belgrader, P.; Heredia, N.J.; Makarewicz, A.J.; Bright, I.J.; Lucero, M.Y.; Hiddessen, A.L.; Legler, T.C.; et al. High-throughput droplet digital PCR system for absolute quantitation of DNA copy number. Anal. Chem. 2011, 83, 8604–8610. [Google Scholar] [CrossRef] [PubMed]
  22. Zatti, M.S.; Arantes, T.D.; Theodoro, R.C. Isothermal nucleic acid amplification techniques for detection and identification of pathogenic fungi: A review. Mycoses 2020, 63, 1006–1020. [Google Scholar] [CrossRef]
  23. Lievens, B.; Justé, A.; Willems, K.A. Fungal plant pathogen detection in plant and soil samples using DNA macroarrays. Methods Mol. Biol. 2012, 835, 491–507. [Google Scholar] [PubMed]
  24. Shahid, M.S.; Sattar, M.N.; Iqbal, Z.; Raza, A.; Al-Sadi, A.M. Next-generation sequencing and the CRISPR-Cas nexus: A molecular plant virology perspective. Front. Microbiol. 2021, 11, 609376. [Google Scholar] [CrossRef]
  25. Werres, S.; Steffens, C. Immunological techniques used with fungal plant pathogens-aspects of antigens, antibodies and assays for diagnosis. Ann. Appl. Biol. 1994, 125, 615–643. [Google Scholar] [CrossRef]
  26. Compton, J. Nucleic acid sequence-based amplification. Nature 1991, 350, 91–92. [Google Scholar] [CrossRef] [PubMed]
  27. Fang, R.; Li, X.; Hu, L.; You, Q.; Li, J.; Wu, J.; Xu, P.; Zhong, H.; Luo, Y.; Mei, J.; et al. Cross-priming amplification for rapid detection of Mycobacterium tuberculosis in sputum specimens. J. Clin. Microbiol. 2009, 47, 845–847. [Google Scholar] [CrossRef]
  28. Fire, A.; Xu, S.Q. Rolling replication of short DNA circles. Proc. Natl. Acad. Sci. USA 1995, 92, 4641–4645. [Google Scholar] [CrossRef]
  29. Li, J.; Macdonald, J.; von Stetten, F. Review: A comprehensive summary of a decade development of the recombinase polymerase amplification. Analyst 2018, 144, 31–67. [Google Scholar] [CrossRef] [PubMed]
  30. Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef]
  31. Vincent, M.; Xu, Y.; Kong, H. Helicase-dependent isothermal DNA amplification. EMBO Rep. 2004, 5, 795–800. [Google Scholar] [CrossRef] [PubMed]
  32. Walker, G.T.; Nadeau, J.G.; Spears, P.A.; Schram, J.L.; Nycz, C.M.; Shank, D.D. Multiplex strand displacement amplification (SDA) and detection of DNA sequences from Mycobacterium tuberculosis and other mycobacteria. Nucleic Acids Res. 1994, 22, 2670–2677. [Google Scholar] [CrossRef] [PubMed]
  33. Almasi, M.A. Development of a colorimetric loop-mediated isothermal amplification assay for the visual detection of Fusarium oxysporum f. sp. melonis. Hortic. Plant J. 2019, 5, 129–136. [Google Scholar] [CrossRef]
  34. Sun, H.; Sun, L.; Yang, L.; Wang, Z.; Xia, Z.; Yang, X.; Jiao, Z.; Feng, J.; Liang, Y. Loop-mediated isothermal amplification assay for rapid detection of Phoma macdonaldii, the causal agent of sunflower black stem. Plant Dis. 2022, 106, 260–265. [Google Scholar] [CrossRef] [PubMed]
  35. Yang, X.; Sun, L.; Sun, H.; Hong, Y.; Xia, Z.; Pang, W.; Piao, Z.; Feng, J.; Liang, Y. A loop-mediated isothermal DNA amplification (LAMP) assay for detection of the clubroot pathogen Plasmodiophora brassicae. Plant Dis. 2022, 106, 1730–1735. [Google Scholar] [CrossRef]
  36. Yao, J.; Huang, P.; Hou, X.; Yu, D. Rapid detection by a loop-mediated isothermal amplification assays based on EF-1α gene for stem rot on Cymbidium ensifolium. Eur. J. Plant Pathol. 2021, 86, 212–218. [Google Scholar] [CrossRef]
  37. Zhang, Y.; Li, X.; Zhang, S.; Ma, T.; Mao, C.; Zhang, C. Quantitative loop-mediated isothermal amplification detection of Ustilaginoidea virens causing tice false smut. Int. J. Mol. Sci. 2023, 24, 10388. [Google Scholar] [CrossRef]
  38. Tomita, N.; Mori, Y.; Kanda, H.; Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat. Protoc. 2008, 3, 877–882. [Google Scholar] [CrossRef] [PubMed]
  39. Nagamine, K.; Kuzuhara, Y.; Notomi, T. Isolation of single-stranded DNA from loop-mediated isothermal amplification products. Biochem. Biophys. Res. Commun. 2002, 290, 1195–1198. [Google Scholar] [CrossRef] [PubMed]
  40. Fischbach, J.; Xander, N.C.; Frohme, M.; Glökler, J.F. Shining a light on LAMP assays’ A comparison of LAMP visualization methods including the novel use of berberine. Biotechniques 2018, 58, 189–194. [Google Scholar] [CrossRef]
  41. Goto, M.; Honda, E.; Ogura, A.; Nomoto, A.; Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. Biotechniques 2009, 46, 167–172. [Google Scholar] [CrossRef] [PubMed]
  42. Mori, Y.; Notomi, T. Loop-mediated isothermal amplification (LAMP): A rapid, accurate, and cost-effective diagnostic method for infectious diseases. J. Infect. Chemother. 2009, 15, 62–69. [Google Scholar] [CrossRef] [PubMed]
  43. Verma, S.; Avishek, K.; Sharma, V.; Negi, N.S.; Ramesh, V.; Salotra, P. Application of loop-mediated isothermal amplification assay for the sensitive and rapid diagnosis of visceral leishmaniasis and post-kala-azar dermal leishmaniasis. Diagn. Microbiol. Infect. Dis. 2013, 75, 390–395. [Google Scholar] [CrossRef] [PubMed]
  44. Denschlag, C.; Vogel, R.F.; Niessen, L. Hyd5 gene-based detection of the major gushing-inducing Fusarium spp. in a loop-mediated isothermal amplification (LAMP) assay. Int. J. Food Microbiol. 2012, 156, 189–196. [Google Scholar] [CrossRef] [PubMed]
  45. Kandan, A.; Akhtar, J.; Singh, B.; Pal, D.; Chand, D.; Agarwal, P.C.; Dubey, S.C. Application of loop-mediated isothermal amplification (LAMP) assay for rapid and sensitive detection of fungal pathogen, Colletotrichum capsici in Capsicum annuum. J. Environ. Biol. 2016, 37, 1355–1360. [Google Scholar]
  46. Niessen, L. Current state and future perspectives of loop-mediated isothermal amplification (LAMP)-based diagnosis of filamentous fungi and yeasts. Appl. Microbiol. Biotechnol. 2015, 99, 553–574. [Google Scholar] [CrossRef] [PubMed]
  47. Niessen, L.; Vogel, R.F. Detection of Fusarium graminearum DNA using a loop-mediated isothermal amplification (LAMP) assay. Int. J. Food Microbiol. 2010, 140, 183–191. [Google Scholar] [CrossRef] [PubMed]
  48. Shen, W.; Xu, G.; Sun, L.; Zhang, L.; Jiang, Z. Development of a loop-mediated isothermal amplification assay for rapid and sensitive detection of Sporisorium scitamineum in sugarcane. Ann. Appl. Biol. 2016, 168, 321–327. [Google Scholar] [CrossRef]
  49. Tian, Q.; Lu, C.; Wang, S.; Xiong, Q.; Zhang, H.; Wang, Y.; Zheng, X. Rapid diagnosis of soybean anthracnose caused by Colletotrichum truncatum using a loop-mediated isothermal amplification (LAMP) assay. Eur. J. Plant Pathol. 2017, 148, 785–793. [Google Scholar] [CrossRef]
  50. Chaliha, C.; Srivastava, R.; Kalita, E.; Sahoo, L.; Verma, P.K. Rapid and precise detection of cryptic tea pathogen Exobasidium vexans: Real Amp validation of LAMP approach. World J. Microbiol. Biotechnol. 2022, 39, 52. [Google Scholar] [CrossRef]
  51. Zou, H.Y.; Li, T.W.; Zhang, J.; Shao, H.; Kageyama, K.; Feng, W. Rapid detection of Colletotrichum siamense from infected tea plants using filter-disc DNA extraction and loop-mediated isothermal amplification. Plant Dis. 2023; online ahead of print. [Google Scholar] [CrossRef]
  52. Cai, L.; Hyde, K.D.; Taylor, P.W.J.; Weir, B.S.; Waller, J.M.; Abang, M.M.; Zhang, J.Z.; Yang, Y.L.; Phoulivong, S.; Liu, Z.Y.; et al. A polyphasic approach for studying Colletotrichum. Fungal Divers. 2009, 39, 183–204. [Google Scholar]
  53. Hou, L.W.; Groenewald, J.Z.; Pfenning, L.H.; Yarden, O.; Crous, P.W.; Cai, L. The phoma-like dilemma. Stud. Mycol. 2020, 96, 309–398. [Google Scholar] [CrossRef] [PubMed]
  54. Lu, Q.; Wang, Y.; Li, N.; Ni, D.; Yang, Y.; Wang, X. Differences in the characteristics and pathogenicity of Colletotrichum camelliae and C. fructicola isolated from the tea plant [Camellia sinensis (L.) O. Kuntze]. Front. Microbiol. 2018, 9, 3060. [Google Scholar] [CrossRef] [PubMed]
  55. Wang, Y.C.; Hao, X.Y.; Wang, L.; Xiao, B.; Wang, X.C.; Yang, Y.J. Diverse Colletotrichum species cause anthracnose of tea plants (Camellia sinensis (L.) O. Kuntze) in China. Sci. Rep. 2016, 6, 35287. [Google Scholar] [CrossRef]
  56. Wang, Y.; Tu, Y.; Chen, X.; Jiang, H.; Ren, H.; Lu, Q.; Wei, C.; Lv, W. Didymellaceae species associated with tea plant (Camellia sinensis) in China. MycoKeys 2024, 105, 217–251. [Google Scholar] [CrossRef] [PubMed]
  57. Lu, Y.; Wang, Y.; Yuan, X.; Huang, O.; Dong, Q.; Li, D.; Ding, S.; Ma, F.; Yu, H. Genomic comparative analysis of Cordyceps pseudotenuipes with other species from Cordyceps. Metabolites 2022, 12, 844. [Google Scholar] [CrossRef]
  58. Wang, Y.; Yang, Y.; Jiang, X.; Shi, J.; Yang, Y.; Jiang, S.; Li, D.; Wang, D.; Chen, Z. The sequence and integrated analysis of competing endogenous RNAs originating from tea leaves infected by the pathogen of tea leaf spot, Didymella segeticola. Plant Dis. 2022, 106, 1286–1290. [Google Scholar] [CrossRef] [PubMed]
  59. Chen, Q.; Zhang, K.; Zhang, G.Z.; Cai, L. A polyphasic approach to characterize two novel species of Phoma (Didymellaceae) from China. Phytotaxa 2015, 197, 267–281. [Google Scholar] [CrossRef]
  60. Huang, H.; Li, D.; Jiang, S.; Yang, R.; Yang, Y.; Xia, Z.; Jiang, X.; Zhao, Y.; Wang, D.; Song, B.; et al. Integrated transcriptome and proteome analysis reveals that the antimicrobial griseofulvin targets Didymella segeticola beta-tubulin to control tea leaf spot. Phytopathology 2023, 113, 194–205. [Google Scholar] [CrossRef] [PubMed]
  61. Ariyawansa, H.A.; Tsai, I.; Thambugala, K.M.; Chuang, W.Y.; Lin, S.R.; Hozzein, W.N.; Cheewangkoon, R. Species diversity of Pleosporalean taxa associated with Camellia sinensis (L.) Kuntze in Taiwan. Sci. Rep. 2020, 10, 12762. [Google Scholar] [CrossRef]
  62. Wong, Y.P.; Othman, S.; Lao, Y.L.; Radu, S.; Chee, H.Y. Loop-mediated isothermal amplification (LAMP): A versatile technique for detection of micro-organisms. J. Appl. Microbiol. 2018, 124, 626–643. [Google Scholar] [CrossRef] [PubMed]
  63. Nagamine, K.; Hase, T.; Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell. Probes 2002, 16, 223–229. [Google Scholar] [CrossRef] [PubMed]
  64. Parida, M.; Sannarangaiah, S.; Dash, P.K.; Rao, P.V.L.; Morita, K. Loop-mediated isothermal amplification (LAMP): A new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases. Rev. Med. Virol. 2008, 18, 407–421. [Google Scholar] [CrossRef] [PubMed]
  65. Choi, C.W.; Hyun, J.W.; Hwang, R.Y.; Powell, C.A. Loop-mediated isothermal amplification assay for detection of Candidatus Liberibacter asiaticus, a causal agent of citrus huanglongbing. Plant Pathol. J. 2018, 34, 499–505. [Google Scholar] [CrossRef] [PubMed]
  66. Li, L.; Zhang, S.Y.; Zhang, C.Q. Establishment of a rapid detection method for rice blast fungus based on one-step loop-mediated isothermal amplification (LAMP). Plant Dis. 2019, 103, 1967–1973. [Google Scholar] [CrossRef] [PubMed]
  67. Wang, Q.W.; Zhang, C.Q. q-LAMP assays for the detection of Botryosphaeria dothidea causing Chinese hickory canker in trunk, water, and air samples. Plant Dis. 2019, 103, 3142–3149. [Google Scholar] [CrossRef]
  68. Cao, Y.; Wang, L.; Duan, L.; Li, J.; Ma, J.; Xie, S.; Shi, L.; Li, H. Development of a real-time fluorescence loop-mediated isothermal amplification assay for rapid and quantitative detection of Ustilago maydis. Sci. Rep. 2017, 7, 13394. [Google Scholar] [CrossRef] [PubMed]
  69. Peng, J.; Zhang, H.; Chen, F.; Zhang, X.; Xie, Y.; Hou, X.; Li, G.; Pu, J. Rapid and quantitative detection of Fusarium oxysporum f. sp. cubense race 4 in soil by real-time fluorescence loop-mediated isothermal amplification. J. Appl. Microbiol. 2015; 117, 1740–1749. [Google Scholar]
  70. Gomez-Gutierrez, S.V.; Goodwin, S.B. Loop-mediated isothermal amplification for detection of plant pathogens in wheat (Triticum aestivum). Front. Plant Sci. 2022, 13, 857673. [Google Scholar] [CrossRef]
  71. Thierry, M.; Chatet, A.; Fournier, E.; Tharreau, D.; Ioos, R. A PCR, qPCR, and LAMP toolkit for the detection of the wheat blast pathogen in seeds. Plants 2020, 9, 277. [Google Scholar] [CrossRef]
Jof 10 00467 g001
Figure 1. Specificity of the loop-mediated isothermal DNA amplification (LAMP) assay for detecting of Didymella segeticola. (A) Agarose gel electrophoresis of LAMP products of D. segeticola and other fungi. M, DL5000 DNA marker; Lane 1, D. segeticola YCW109; Lane 2, D. segeticola YCW1289; Lane 3, D. segeticola YCW1135; Lane 4, D. segeticola YCW205; Lane 5, D. coffeae-arabicae YCW1972; Lane 6, D. pomorum YCW196; Lane 7, D. sinensis YCW1906; Lane 8, D. sinensis YCW1950; Lane 9, Stagonosporopsis caricae YCW1928; Lane 10, Colletotrichum camelliae LS_19; Lane 11, no-template (ddH2O) control. (B) Color changes in LAMP products following the addition of SYBR Green I.
Figure 1. Specificity of the loop-mediated isothermal DNA amplification (LAMP) assay for detecting of Didymella segeticola. (A) Agarose gel electrophoresis of LAMP products of D. segeticola and other fungi. M, DL5000 DNA marker; Lane 1, D. segeticola YCW109; Lane 2, D. segeticola YCW1289; Lane 3, D. segeticola YCW1135; Lane 4, D. segeticola YCW205; Lane 5, D. coffeae-arabicae YCW1972; Lane 6, D. pomorum YCW196; Lane 7, D. sinensis YCW1906; Lane 8, D. sinensis YCW1950; Lane 9, Stagonosporopsis caricae YCW1928; Lane 10, Colletotrichum camelliae LS_19; Lane 11, no-template (ddH2O) control. (B) Color changes in LAMP products following the addition of SYBR Green I.
Jof 10 00467 g001
Jof 10 00467 g002
Figure 2. Optimization of the LAMP reaction conditions. (A) Reaction temperature screening. Lanes 1 and 9, 55 °C; Lanes 2 and 10, 58 °C; Lanes 3 and 11, 60 °C; Lanes 4 and 12, 62 °C; Lanes 5 and 13, 65 °C; Lanes 6 and 14, 68 °C; Lanes 7 and 15, 70 °C; Lanes 8 and 16, no-template (ddH2O) control. (B) Reaction time screening. Lanes 1 and 8, 15 min; Lanes 2 and 9, 30 min; Lanes 3 and 10, 45 min; Lanes 4 and 11, 60 min; Lanes 5 and 12, 75 min; Lanes 6 and 13, 90 min; Lanes 7 and 14, no-template (ddH2O) control. M, DL5000 DNA marker.
Figure 2. Optimization of the LAMP reaction conditions. (A) Reaction temperature screening. Lanes 1 and 9, 55 °C; Lanes 2 and 10, 58 °C; Lanes 3 and 11, 60 °C; Lanes 4 and 12, 62 °C; Lanes 5 and 13, 65 °C; Lanes 6 and 14, 68 °C; Lanes 7 and 15, 70 °C; Lanes 8 and 16, no-template (ddH2O) control. (B) Reaction time screening. Lanes 1 and 8, 15 min; Lanes 2 and 9, 30 min; Lanes 3 and 10, 45 min; Lanes 4 and 11, 60 min; Lanes 5 and 12, 75 min; Lanes 6 and 13, 90 min; Lanes 7 and 14, no-template (ddH2O) control. M, DL5000 DNA marker.
Jof 10 00467 g002
Jof 10 00467 g003
Figure 3. Sensitivity of the LAMP assay. Agarose gel electrophoresis and color changes of LAMP products with serially diluted genomic DNA (from 10 ng/µL to 10 ag/µL) from D. segeticola isolates YCW109 (A), YCW1135 (B), and YCW1289 (C) as templates. The detection limit was 1 fg/µL. The sensitivity of the assay was determined by the addition of SYBR Green I. The reactions were positive and presented a yellowish-green color. Lane 1, 10 ng/µL; Lane 2, 1 ng/µL; Lane 3, 100 pg/µL; Lane 4, 10 pg/µL; Lane 5, 1 pg/µL; Lane 6, 100 fg/µL; Lane 7, 10 fg/µL. Lane 8, 1 fg/µL; Lane 9, 100 ag/µL; Lane 10, 10 ag/µL; Lane 11, no-template (ddH2O) control. M, DL5000 DNA marker.
Figure 3. Sensitivity of the LAMP assay. Agarose gel electrophoresis and color changes of LAMP products with serially diluted genomic DNA (from 10 ng/µL to 10 ag/µL) from D. segeticola isolates YCW109 (A), YCW1135 (B), and YCW1289 (C) as templates. The detection limit was 1 fg/µL. The sensitivity of the assay was determined by the addition of SYBR Green I. The reactions were positive and presented a yellowish-green color. Lane 1, 10 ng/µL; Lane 2, 1 ng/µL; Lane 3, 100 pg/µL; Lane 4, 10 pg/µL; Lane 5, 1 pg/µL; Lane 6, 100 fg/µL; Lane 7, 10 fg/µL. Lane 8, 1 fg/µL; Lane 9, 100 ag/µL; Lane 10, 10 ag/µL; Lane 11, no-template (ddH2O) control. M, DL5000 DNA marker.
Jof 10 00467 g003
Jof 10 00467 g004
Figure 4. LAMP assay for detecting D. segeticola in inoculated tea leaves of LJ43, ZC102, ZC108, and ZC302. (A) Symptoms on leaves from different cultivars of tea plant (Camellia sinensis) 3 days after inoculation with D. segeticola isolates. (B) Agarose gel electrophoresis and color changes showing the LAMP results. The LAMP assays were performed using the genomic DNA from diseased leaves, which were inoculated with D. segeticola isolates, as templates. Lane 1: YCW109; Lane 2: YCW192; Lane 3: YCW1111; Lane 4: YCW1135; Lane 5: YCW1289; Lane 6: YCW2184; Lane 7: YCW2007; Lane 8: negative control (ddH2O). M, DL5000 DNA marker.
Figure 4. LAMP assay for detecting D. segeticola in inoculated tea leaves of LJ43, ZC102, ZC108, and ZC302. (A) Symptoms on leaves from different cultivars of tea plant (Camellia sinensis) 3 days after inoculation with D. segeticola isolates. (B) Agarose gel electrophoresis and color changes showing the LAMP results. The LAMP assays were performed using the genomic DNA from diseased leaves, which were inoculated with D. segeticola isolates, as templates. Lane 1: YCW109; Lane 2: YCW192; Lane 3: YCW1111; Lane 4: YCW1135; Lane 5: YCW1289; Lane 6: YCW2184; Lane 7: YCW2007; Lane 8: negative control (ddH2O). M, DL5000 DNA marker.
Jof 10 00467 g004
Jof 10 00467 g005
Figure 5. Detection of D. segeticola in healthy leaves of 18 germplasms of tea plants in the field. (A) Healthy leaves of different tea germplasms. (B) Agarose gel electrophoresis and color changes showing the LAMP results. Lane 1: 2018-M89; Lane 2: 2018-M90; Lane 3: 2018-M95; Lane 4: 2018-M86; Lane 5: 2018-M100; Lane 6: 2021-WZ-7; Lane 7: AJ15; Lane 8: AJ16; Lane 9: AJ17; Lane 10: AJ18; Lane 11: 2021-20M; Lane 12: 2021-38M; Lane 13: 2021-19M; Lane 14: 2021-45M; Lane 15: 2021-2-2-M; Lane 16: 2021-01-M; Lane 17: 2021-2-6-M; Lane 18: 2021-3-11-M; Lane 19: positive control (DNA extracted from diseased leaves of LJ43 inoculated with D. segeticola strain YCW2184). M, DL5000 DNA marker.
Figure 5. Detection of D. segeticola in healthy leaves of 18 germplasms of tea plants in the field. (A) Healthy leaves of different tea germplasms. (B) Agarose gel electrophoresis and color changes showing the LAMP results. Lane 1: 2018-M89; Lane 2: 2018-M90; Lane 3: 2018-M95; Lane 4: 2018-M86; Lane 5: 2018-M100; Lane 6: 2021-WZ-7; Lane 7: AJ15; Lane 8: AJ16; Lane 9: AJ17; Lane 10: AJ18; Lane 11: 2021-20M; Lane 12: 2021-38M; Lane 13: 2021-19M; Lane 14: 2021-45M; Lane 15: 2021-2-2-M; Lane 16: 2021-01-M; Lane 17: 2021-2-6-M; Lane 18: 2021-3-11-M; Lane 19: positive control (DNA extracted from diseased leaves of LJ43 inoculated with D. segeticola strain YCW2184). M, DL5000 DNA marker.
Jof 10 00467 g005
Jof 10 00467 g006
Figure 6. Detection of D. segeticola in diseased leaves of 18 germplasms of tea plants in the field. (A) Diseased leaves of different tea germplasms. (B) Agarose gel electrophoresis and color changes showing the LAMP results. Lane 1: 2018-M89; Lane 2: 2018-M90; Lane 3: 2018-M95; Lane 4: 2018-M86; Lane 5: 2018-M100; Lane 6: 2021-WZ-7; Lane 7: AJ15; Lane 8: AJ16; Lane 9: AJ17; Lane 10: AJ18; Lane 11: 2021-20M; Lane 12: 2021-38M; Lane 13: 2021-19M; Lane 14: 2021-45M; Lane 15: 2021-2-2-M; Lane 16: 2021-01-M; Lane 17: 2021-2-6-M; Lane 18: 2021-3-11-M; Lane 19: positive control (DNA extracted from diseased leaves of LJ43 inoculated with D. segeticola strain YCW2184). M, DL5000 DNA marker.
Figure 6. Detection of D. segeticola in diseased leaves of 18 germplasms of tea plants in the field. (A) Diseased leaves of different tea germplasms. (B) Agarose gel electrophoresis and color changes showing the LAMP results. Lane 1: 2018-M89; Lane 2: 2018-M90; Lane 3: 2018-M95; Lane 4: 2018-M86; Lane 5: 2018-M100; Lane 6: 2021-WZ-7; Lane 7: AJ15; Lane 8: AJ16; Lane 9: AJ17; Lane 10: AJ18; Lane 11: 2021-20M; Lane 12: 2021-38M; Lane 13: 2021-19M; Lane 14: 2021-45M; Lane 15: 2021-2-2-M; Lane 16: 2021-01-M; Lane 17: 2021-2-6-M; Lane 18: 2021-3-11-M; Lane 19: positive control (DNA extracted from diseased leaves of LJ43 inoculated with D. segeticola strain YCW2184). M, DL5000 DNA marker.
Jof 10 00467 g006
Table 1. Isolates first used in this study and GenBank accession numbers of the generated sequences.
Table 1. Isolates first used in this study and GenBank accession numbers of the generated sequences.
SpeciesCollecting LocationTested IsolatesGenBank Accessions
ITSrpb2tub2LSU
Colletotrichum camelliaeLishui, Zhejiang, ChinaLS_19MH463803/MH478602/
Didymella coffeae-arabicaePuer, Yunnan, ChinaYCW1972OP647946OP854293//
D. pomorumYunnan, ChinaYCW196OP647945OP854292OP854550OP836938
D. segeticolaYixing, Jiangsu, ChinaYCW109OP647864OP854211OP854392OP836867
Lishui, Zhejiang, ChinaYCW192OP647940OP854287OP854444OP836877
Yunnan, ChinaYCW205OP647949OP854296OP854528OP836907
Wuxi, Jiangsu, ChinaYCW1111OP647871OP854218OP854397OP836869
Hangzhou, Zhejiang, ChinaYCW1135OP647884OP854231OP854507OP836941
Hangzhou, Zhejiang, ChinaYCW1289OP647910OP854257OP854430OP836875
Puer, Yunnan, ChinaYCW2007OP647948OP854295OP854512OP836934
Hangzhou, Zhejiang, ChinaYCW2184OP647961OP854308/OP836933
D. sinensisPuer, Yunnan, ChinaYCW1906OP647938OP854285OP854548/
Puer, Yunnan, ChinaYCW1950OP647943OP854290OP854549/
Stagonosporopsis caricaePuer, Yunnan, ChinaYCW1928OP648100/OP854594OP837293
Table 2. Primers used for the LAMP assay to detect D. segeticola.
Table 2. Primers used for the LAMP assay to detect D. segeticola.
PrimerSequence (5′-3′)
F3CTTGGTCGAGCATAGAGCG
B3CCTAGTCAGCACGGAACAG
FIPCAGGTGGACGTGGCGTGTTGCACGACCGTTTTGCACAAC
BIPAGCGATGCATGCACGAGCATAGGAAGAGAGATGACAGGGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tu, Y.; Wang, Y.; Jiang, H.; Ren, H.; Wang, X.; Lv, W. A Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Didymella segeticola Causing Tea Leaf Spot. J. Fungi 2024, 10, 467. https://doi.org/10.3390/jof10070467

AMA Style

Tu Y, Wang Y, Jiang H, Ren H, Wang X, Lv W. A Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Didymella segeticola Causing Tea Leaf Spot. Journal of Fungi. 2024; 10(7):467. https://doi.org/10.3390/jof10070467

Chicago/Turabian Style

Tu, Yiyi, Yuchun Wang, Hong Jiang, Hengze Ren, Xinchao Wang, and Wuyun Lv. 2024. "A Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Didymella segeticola Causing Tea Leaf Spot" Journal of Fungi 10, no. 7: 467. https://doi.org/10.3390/jof10070467

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop