Next Article in Journal
Structure and Diversity of Microbiomes Associated with the Gastrointestinal Tracts of Wild Spiny Lobsters and Profiling Their Potential Probiotic Properties Using eDNA Metabarcoding
Previous Article in Journal
Spatiotemporal Variations in Trophic Diversity of Fish Communities in a Marine Bay Ecosystem Based on Stable Isotope Analysis
Previous Article in Special Issue
Biochemical Composition of Eggs, Larvae and Tissues of Macrobrachium tenellum Females Fed Diets with Different Lipid and Protein Levels
 
 
Journals
Fishes
Volume 9
Issue 7
10.3390/fishes9070263
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Functional Study on the BMP Signaling Pathway in the Molting of Scylla paramamosain

by
Botao Zhong
1,
Huaihua Yu
1,
Shengming Han
1,
Weiwei Song
1,2,
Zhiming Ren
1,2,
Chunlin Wang
1,2 and
Changkao Mu
1,2,*
1
Key Laboratory of Green Mariculture (Co-Construction by Ministry and Province), Ministry of Agriculture and Rural, Ningbo University, Ningbo 315211, China
2
Key Laboratory of Aquacultural Biotechnology Ministry of Education, Ningbo University, Ningbo 315211, China
*
Author to whom correspondence should be addressed.
Fishes 2024, 9(7), 263; https://doi.org/10.3390/fishes9070263
Submission received: 17 April 2024 / Revised: 25 June 2024 / Accepted: 25 June 2024 / Published: 4 July 2024
(This article belongs to the Special Issue Nutrition, Physiology and Metabolism of Crustaceans)
Browse Figures
Versions Notes

Abstract

:
In this study, we added LDN-193189 2HCL to inhibit the BMP signaling pathway in Scylla paramamosain and then explored the function of this pathway in molting through the changes in the growth performance and molt-related gene expression. The study findings indicated that the expression of ACVR1, BMPRIB, and Smad1 in Scylla paramamosain was suppressed when the LDN-193189 2HCL concentration in the culture water was 2 µm/L. Subsequently, following a 30-day experiment, there was a significant reduction in the molting frequency, growth rate, and body size of the S. paramamosain larvae. An analysis of the BMP pathway gene expression during the molting phase revealed that the BMP2, BMPR2, and Smad1 genes displayed cyclic expression patterns, while ACVR1, BMP7, and BMPRIB maintained consistent expression levels throughout the molting cycle. Additionally, the expression levels of BMP2, BMPR2, and Smad1 in the inhibition group were significantly lower compared to those in the control group. Furthermore, the inhibition of the BMP pathway led to an increase in the expression of MIH during the intermolt period and a decrease in the expression of EcR during the premolt period. These findings demonstrate that the BMP signaling pathway affects the molting of Scylla paramamosain juvenile crabs by influencing the expression of the critical genes MIH and ECR during molting, offering valuable data for functional research on the BMP signaling pathway in crustaceans.
Keywords:
LDN-193189 2HCL; BMP; molt; Scylla paramamosain
Key Contribution: 1. LDN-193189 2HCL at concentrations ≥ 1 µm/L can inhibit the BMP signaling pathway in S. paramamosain larvae. 2. Inhibiting the BMP signaling pathway has a significant impact on the molting, body size, and weight of S. paramamosain larvae. 3. BMP2, BMPR2, and Smad1 are involved in the molting process. 4. The inhibition of the BMP signaling pathway downregulates the expression of MIH and EcR.

1. Introduction

The mud crab (Scylla paramamosain), valued for its high market demand, serves as a crucial aquaculture species along the East Asian coastline [1]. The molting process, which is essential for its growth and development, not only leads to physical enlargement but also signifies a transition in its physiological state [2,3]. This intricate process involves a complex interplay of endocrine regulation and signal transduction mechanisms. Extensive research has elucidated the molting mechanism in crustaceans, highlighting the fundamental antagonistic interaction between molting hormone (MH) and molt-inhibiting hormone (MIH) [4]. Furthermore, the regulation of calcium ions (Ca2+) plays a critical role in this process [5].
Bone morphogenetic proteins (BMPs), members of the TGF-β superfamily, are growth factors intricately involved in animal growth and development [6]. In aquaculture, BMPs have demonstrated significant roles in biocalcification, tissue regeneration, and reproductive regulation. Studies have indicated that BMP2 and BMP4 show elevated expression levels in actively mineralizing tissues such as fish vertebrae and fins, underscoring their importance in biomineralization and skeletal development [7,8]. Within bivalves, genes such as BMP2, BMP3, BMP7, BMP7b, and BMP10 are key players in shell damage repair and calcification [9,10]. In Eriocheir sinensis, the expression of BMP2 and BMPR2 is significantly higher in the postmolt period than in the intermolt period [11]. Furthermore, BMP2 and BMP7 are closely associated with germ cell generation and sperm maturation in both Eriocheir sinensis and S. paramamosain [12,13]. Some studies have investigated the function of the BMP signaling pathway. In S. paramamosain, BMP2 has been shown to be involved in ovarian development and hormonal regulation [14], and Smad1 has been shown to be involved in immune response translation [15]. However, there has been no research reported on the functional study of BMPs in the molting process of S. paramamosain.
The transduction of the BMP signaling pathway relies on the interaction between BMPs and their specific type I and type II receptors. This interaction initiates the activation of the intracellular Smad signaling pathway as well as diverse non-Smad pathways [16]. Previous research has demonstrated that the inhibitor Dorsomorphin and its derivative LDN-193189 2HCl dose-dependently impede the phosphorylation of Smad1/5/8, thereby obstructing BMP signaling pathway transduction. However, Dorsomorphin also inhibits AMP-activated kinase (AMPK) and the receptor tyrosine kinases involved in PDGF and VEGF interactions [17]. Our previous work initially screened the inhibitor LDN-193189 2HCl to determine the minimum concentration necessary to inhibit the BMP signaling pathway in S. paramamosain larvae. Subsequently, the larvae underwent a 30-day immersion culture at this concentration to explore the role of the BMP signaling pathway in mud crab molting, laying the groundwork for further investigations into the biological functions of this pathway in crustaceans.

2. Materials and Methods

2.1. Experimental Design and Management

The experimental protocol was approved by the Committee for Animal Conservation and Utilization at Ningbo University and conducted at the College of Marine Science at Ningbo University from September to October 2023. The megalopae of S. paramamosain were sourced from DaSheng Technology Co., Ltd. (Ningbo, China).
The experimental design for the inhibitor concentration screening was as follows: 2000 healthy, active, and intact megalopae were randomly distributed into 20 acrylic tanks (20 × 10 × 20 cm, 4 L). LDN-193189 2HCl was diluted in seawater to create five concentration groups: 0, 0.1 μmol/L, 0.5 μmol/L, 1 μmol/L, 2 μmol/L, and 4 μmol/L, with each treatment having four replicates. The larvae were fed frozen adult Artemia twice a day at 8:00 AM and 5:00 PM, with a complete water change every 48 h along with the addition of the inhibitor. The sampling time points were set at 6 h, 24 h, 48 h, 72 h, and 96 h. Samples were rinsed with PBS 2–3 times before being immediately frozen in liquid nitrogen for subsequent gene expression analysis. Survival rates and molting rates were calculated once all larvae in the control group had molted into juvenile crabs. Based on the above analysis, a suitable inhibitory concentration will be selected for subsequent experiments.
Subsequent daily management remained the same, and the rearing continued until all juvenile crabs in the experimental group had molted into the C IV stage. Samples were collected during the megalopa and C I stages at the time points of 6 h, 24 h, 48 h, and 72 h, during the premolt stage (24 h before molting) and the postmolt stage (C I soft-shelled crab). The weights were measured using an analytical balance 24 h after each molt. The full carapace width (FCW) and length (FCL) of the crabs were measured using an HDCE-X5 digital camera and ScopeImage 9.0 under a dissecting microscope (NiKang, Shanghai, China), while the average molting time and survival rates for each stage were recorded. Additionally, to investigate the role of the BMP signaling pathway in molting, the hepatopancreas tissues were collected during the intermolt stage of C III (C), the premolt stage of C III (D), and the postmolt stage of C IV (AB) and preserved in a freezer at −80 °C.
During the experiment, the water quality parameters were maintained as follows: salinity 24–27 psu; temperature 25 °C; pH 8–8.5; dissolved oxygen ≥ 6 mg L−1; ammonia nitrogen < 0.1 mg L−1.

2.2. Gene Expression Analysis

Total RNA extraction was performed using a commercial RNA extraction kit (Omega Biotek, Norcross, GA, USA). Following extraction, 4 µL of the isolated RNA was utilized for agarose gel electrophoresis to verify the quality of the extraction. The electrophoresis conditions were set to 120 V and 140 mA for 10 min. Additionally, the RNA concentration and quality were assessed using a spectrophotometer (MaestroGEN, Taiwan, China). Upon confirming the high quality of the extracted RNA, the HiFiScript gDNA Removal RT MasterMix kit (Cwbio, Beijing, China) was used to eliminate the genomic DNA and synthesize cDNA.
The relative expression levels of ACVR1, BMPRIB, Smad1, MIH, EcR, BMP7, BMP2, and BMPR2 were analyzed using real-time quantitative PCR (LightCycler 480, Roche, Detroit, MI, USA) and the SYBR Premix Ex Taq kit (CWBIO, Beijing, China). The reaction mixture had a total volume of 20 µL (10 µL 2× Es Taq Master Mix, 8.2 μL ddH2O, 0.4 μL each primer, 1 µL cDNA). The primers used in this experiment are listed in Table 1 (Youkang Biological Technology Co., Ltd., Hangzhou, China). The real-time quantitative PCR conditions were as follows: pre-denaturation at 95 °C for 30 s; 40 cycles at 95 °C for 5 s and 60 °C for 30 s; and 95 °C for 15 s. The relative expression level of the target genes was calculated and analyzed using the equation 2−ΔΔCT.

2.3. Calculations

The survival rate, molting rate, weight gain rate, and specific growth rate were calculated using the following formulas:
survival rate(%) = Nt/N0 × 100;
molting rate (%) = Mt/N0 × 100;
WGR (%) = (Wt − W0) × 100/Wt
SGR (%) = (lnWt − lnW0) × 100/t.
where Nt is the number of surviving larvae at the end of cultivation; N0 is the initial number of larvae; Mt is the number of C I juvenile crabs at the end of cultivation; Wt is the average weight of crabs at the end of cultivation (g); W0 is the average weight of megalopae at the start of cultivation (g); t is the duration of the experiment (d); WGR is the specific weight gain rate; and SGR is the specific growth rate.

2.4. Statistical Analysis

All data were analyzed using SPSS 22.0 and plotted using GraphPad Prism 9.0. The data were checked for normal distribution and variance homogeneity using the Kolmogorov–Smirnov test and Levene’s test. One-way ANOVA (one-way analysis of variance) and independent samples t-tests were employed to compare the differences between treatment groups and control groups. Statistical significance was set at p < 0.05 for significant differences and p < 0.01 for highly significant differences. The growth parameters were expressed as the mean ± standard deviation (mean ± SD).

3. Results

3.1. Survival and Molting Rate at Different Concentrations

The inhibitor at a concentration of 0.1 μmol/L showed no significant impact on the growth and molting of megalopae (p > 0.05). However, concentrations of 1 μmol/L and 2 μmol/L of the inhibitor affected the survival of the megalopae (Figure 1A,B), leading to a significant decrease in their survival rate. Furthermore, the inhibitor at a concentration of 2 μmol/L also resulted in a significant reduction in the molting rate of the megalopae (p < 0.05). At a concentration of 4 μmol/L, the inhibitor significantly reduced the survival and molting rates of the megalopae (p < 0.05). Under the influence of the inhibitor at 4 μmol/L, the megalopae could hardly survive and experienced a high mortality rate, with only a few individuals successfully molting.

3.2. Expression of ACVR1 at Different Concentrations

The inhibitor at a concentration of 0.1 μmol/L had no significant impact on the expression of the ACVR1 (p > 0.05) (Figure 2). However, the inhibitors at concentrations of 1 μmol/L and 2 μmol/L both significantly suppressed the expression of the ACVR1 (p < 0.05). Additionally, compared to the 1 μmol/L concentration group, the group treated with a concentration of 2 μmol/L exhibited an earlier onset and a more pronounced reduction in the expression of ACVR1. To ensure the effective inhibition of the BMP signaling pathway by the inhibitor LDN-193189 2HCL, a concentration of 2 μmol/L was selected for further research.

3.3. Expression of BMP-Related Genes at a Concentration of 2 μmol/L

The relative expression level of ACVR1 in the S. paramamosain megalopae treated with the 2 μmol/L inhibitor was significantly decreased at 24 h and 48 h (Figure 3A). Additionally, the expression levels of BMPRIB and Smad1 were significantly reduced at 48 h and 72 h compared with the control group. (p < 0.05) (Figure 3B,C). But after 72 h, this inhibitory effect weakened. The findings collectively suggest that treatment with 2 μmol/L LDN-193189 2HCL effectively inhibits BMP signaling pathway transduction in the megalopae of S. paramamosain.

3.4. Growth Performance

The average weights of the megalopae in the control and experimental groups were 0.0049 ± 0.0010 g and 0.0048 ± 0.001 g, respectively. After a 30-day rearing period, the weight of the control group’s juvenile crabs was significantly higher than that of the experimental group starting from C II (Figure 4). The weight gain rate and average growth rate for the control group were 1859.67% ± 82.43 and 9.91% ± 0.16, while for the experimental group, they were 736.73% ± 39.75 and 6.07% ± 0.11 (Table 2). Starting from the C II stage, the weight, full carapace length (FCL), full carapace width (FCW), weight gain rate (WGR), and specific growth rate (SGR) of the experimental group crabs were significantly lower than those of the control group (p < 0.01) (Table 2 and Table 3). From the megalopa to the C IV stage, at each stage, the average molting interval of the control group was significantly lower than that of the experimental group (p < 0.05) (Figure 5).

3.5. Differential Gene Expression of the BMP Signaling Pathway across Molting Stages

To screen the key genes involved in molting in the BMP signaling pathway, the expression levels of the BMP genes during different molting stages were detected. The expression levels of ACVR1, BMP7, and BMPRIB remained consistently stable across the entire molting cycle (Figure 6D–F). In contrast, BMPR2, BMP2, and Smad1 displayed a distinct pattern of expression during the molting cycle, characterized by lower levels during the intermolt (C) and premolt (D) stages (Figure 6A–C). As molting advanced, there was a marked increase in their expression levels during the postmolt (AB) stage (p < 0.05).

3.6. Expression of BMPR2, Smad1, and BMP2 at Different Molt Stages

LDN-193189 2HCL at a concentration of 2 μmol/L impacted the expression of BMPR2, Smad1, and BMP2 throughout the molting cycle. BMPR2 and Smad1 demonstrated significant downregulation during the intermolt stage compared to the control group (p < 0.05) (Figure 7A,C), with no significant variance in the premolt and postmolt stages (p > 0.05). BMP2 experienced significant downregulation in the postmolt stage in comparison to the control group (p < 0.01) (Figure 7B).

3.7. Molt-Related Gene Expression

The treatment with the 2 μmol/L inhibitor significantly increased the expression levels of MIH at 72 h, 96 h (p < 0.01), and during premolting (p < 0.05) (Figure 8A), Additionally, it significantly reduced the expression levels of EcR in both the premolting stage (p < 0.01) and postmolting stage (p < 0.05) (Figure 8B).

4. Discussion

LDN-193189 2HCl has been extensively used to investigate the role of the BMP signaling pathway in tumorigenesis, stem cell differentiation, and biological development. For example, the BMP signaling pathway was suppressed by administering LDN-193189 to mice, and the involvement of the BMP signaling pathway in cancer dissemination was evaluated through the metastatic growth rate of cancer cells in bone [18]. Furthermore, injections of LDN-193189 were administered to zebrafish embryos to investigate the role of the BMP signaling pathway in vascular development [17].
In this study, as the concentration of the inhibitor increased, there was a significant decrease in the molting and survival rates of the megalopae (Figure 1), along with a notable reduction in the expression level of ACVR1 (Figure 2). Previous studies have indicated that with an increase in the LDN-193189 2HCL concentration, there is a marked decrease in the vitality of Echinococcus multilocularis [19], accompanied by deformities and mortality, aligning with the findings of our study. Furthermore, treatment with the inhibitor at a concentration of 2 μmol/L resulted in a significant decrease in the expression levels of BMPRIB, ACVR1, and Smad1 in the megalopa larvae (Figure 3). The transduction of the BMP signaling pathway relies on the phosphorylation of Smad1/5/8 [20]. While the activation of this phosphorylation process is dependent on the binding of the type I receptor BMPRIB, ACVR1 binds to the type II receptor [21,22]. The result suggests that this concentration of inhibitor can effectively inhibit the BMP signaling pathway in S. paramamosain.
In the hepatopancreatic tissues of S. paramamosain juvenile crabs at different molt stages, the expression of ACVR1, BMP7, and BMPR1B did not change significantly throughout the molt cycle, whereas BMP2, BMPR2, and Smad1 were significantly upregulated from the molt interphase. The results of the transcriptomic studies on the molt cycle of E. sinensis also showed that the expression of BMPR2 and ACVR1 was significantly upregulated after molting compared to the premolt stage [11]. BMP2, BMPR2, and Smad1 may play a more important role in molting.
Most members of the BMP family have been shown to play important regulatory roles in biological calcification and tissue reconstruction [23]. BMP2 is considered to be the sole factor capable of inducing bone formation independently and has been extensively studied in the formation of skeletons and cartilage in various animals [24]. In mollusks, BMP2 has been shown to be associated with biomineralization and shell development in species such as Meretrix meretrix [25] and Pinctada fucata [26]. As one of the receptors in the BMP signaling pathway, BMPR2 can bind to BMP2, 4, 6, and 7, and it has been reported that the physiological effects of BMPR2 depend on its combination with ligands [27]. Mice with silenced Smad1 can still survive and reproduce; however, the combined loss of Smad1, 5, and 8 leads to severe cartilage developmental defects in mice. This suggests that Smad1 plays a primary role in signal transduction during cartilage formation and bone differentiation [28]. In this study, BMPR2 and Smad1 expression in the hepatopancreas of juvenile crabs treated with the inhibitors was downregulated during the intermolt period, and BMP2 expression was significantly downregulated during the postmolt period. (Figure 7). During the molting process of crustaceans, the hepatopancreas serves as the primary storage site for calcium ions. From the premolt to postmolt stages, the calcium ion content in the hepatopancreas reaches its peak and gradually decreases as the shell hardens [29]. These results further suggest that the inhibition of the BMP signaling pathway may regulate molting by inhibiting calcium-ion-regulated processes in S. paramamosain.
The primary function of MIH is to regulate the molting process of crustaceans by inhibiting the synthesis of molting hormones in the Y-organ [30]. Ecdysone receptor (EcR), the target of ecdysone, is present at the onset of the cascade of life processes in crustaceans such as molting, reproduction, and metamorphosis, and its expression varies significantly between molting stages [31]. Existing studies have shown that the expression of MIH is significantly negatively correlated with body weight at different molt cycles in E. sinensis, while the expression of EcR is significantly positively correlated with body weight at different molt cycles [32]. In addition, MIH has been shown to directly affect crustacean body weights [33]. MIH is also important for maintaining the length of the intermolt period in crustaceans: the injection of a molt-inhibiting hormone significantly prolongs the molt time in Homaru americanus [34]. In Metopograpsus messor, the expression of EcR fluctuated with its growing season and was significantly higher during the growing season, in which its weight gain rate was higher [35]. In this study, treatment with 2 μmol/L LDN-193189 2HCL resulted in a reduction in the size and weight of the larvae crabs, along with a significant extension of the molting duration. Furthermore, it led to a notable increase in the expression of MIH (Figure 8A) and a significant decrease in the expression levels of EcR (Figure 8B). This suggests that the inhibition of the BMP signaling pathway may affect the expression of MIH and EcR, which leads to the inhibition of the growth process.

5. Conclusions

In summary, inhibiting the BMP signaling pathway with LDN-193189 resulted in the suppression of the molting process in the S. paramamosain. The key outcomes included a prolonged molting duration and reduced body weight and size. The BMP signaling pathway may regulate the molting physiological process through a combined effect on the expression levels of MIH and EcR and the process of exoskeleton hardening.

Author Contributions

Conceptualization, B.Z.; Methodology, H.Y.; Software, B.Z.; Validation, B.Z.; Formal analysis, H.Y.; Investigation, S.H.; Resources, Z.R.; Data curation, B.Z.; Writing—original draft, B.Z.; Writing—review and editing, B.Z; Supervision, W.S.; Project administration, C.M.; Funding acquisition, C.W. and C.M. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Modern Technology System of Agricultural Industry (No: CARS-48).

Institutional Review Board Statement

This study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Animal Ethics Committee of Ningbo University. In China, academic research on S. paramamosain is highly encouraged and does not necessitate particular permits.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data supporting these findings of this study are included in the manuscript.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

References

  1. Ut, V.N.; Le Vay, L.; Nghia, T.T.; Hong Hanh, T.T. Development of nursery culture techniques for the mud crab Scylla paramamosain (Estampador). Aquac. Res. 2007, 38, 1563–1568. [Google Scholar] [CrossRef]
  2. Hosamani, N.; Reddy, S.; Reddy, R. Crustacean molting: Regulation and effects of environmental toxicants. J. Mar. Sci. Res. Dev. 2017, 7, 5. [Google Scholar] [CrossRef]
  3. Gore, R.H. Molting and growth in decapod larvae. In Crustacean Issues 2; Routledge: Abington, UK, 2017; pp. 1–65. [Google Scholar]
  4. Huang, H.; Fu, C.; Chen, X.; Gong, J.; Huang, X.; Ye, H. Molt-inhibiting hormone (MIH) gene from the green mud crab Scylla paramamosain and its expression during the molting and ovarian cycle. Aquac. Res. 2015, 46, 2665–2675. [Google Scholar] [CrossRef]
  5. Greenavvay, P. Calcium balance and moulting in the Crustacea. Biol. Rev. 1985, 6, 425–454. [Google Scholar] [CrossRef]
  6. Brazil, D.P.; Church, R.H.; Surae, S.; Godson, C.; Martin, F. BMP signalling: Agony and antagony in the family. Trends Cell Biol. 2015, 25, 249–264. [Google Scholar] [CrossRef] [PubMed]
  7. Höch, R.; Schneider, R.F.; Kickuth, A.; Meyer, A.; Woltering, J.M. Spiny and soft-rayed fin domains in acanthomorph fish are established through a BMP-gremlin-shh signaling network. Proc. Natl. Acad. Sci. USA 2021, 118, e2101783118. [Google Scholar] [CrossRef] [PubMed]
  8. Smith, A.; Avaron, F.; Guay, D.; Padhi, B.D.; Akimenko, M. Inhibition of BMP signaling during zebrafish fin regeneration disrupts fin growth and scleroblast differentiation and function. Dev. Biol. 2006, 299, 438–454. [Google Scholar] [CrossRef] [PubMed]
  9. Kin, K.; Kakoi, S.; Wada, H. A novel role for dpp in the shaping of bivalve shells revealed in a conserved molluscan developmental program. Dev. Biol. 2009, 329, 152–166. [Google Scholar] [CrossRef]
  10. Cavallo, A.; Clark, M.S.; Peck, L.S.; Harper, E.M.; Sleight, V.A. Evolutionary conservation and divergence of the transcriptional regulation of bivalve shell secretion across life-history stages. R. Soc. Open Sci. 2022, 9, 221022. [Google Scholar] [CrossRef]
  11. Wang, M.; Zhou, J.; Su, S.; Tang, Y.; Xu, G.; Li, J.; Yu, F.; Li, H.; Song, C.; Liang, M. Comparative transcriptome analysis on the regulatory mechanism of thoracic ganglia in Eriocheir sinensis at post-molt and inter-molt Stages. Life 2022, 12, 1181. [Google Scholar] [CrossRef]
  12. Xu, Y.-R.; Wang, G.-Y.; Zhou, Y.-C.; Yang, W.-X. The characterization and potential roles of bone morphogenetic protein 7 during spermatogenesis in Chinese mitten crab Eriocheir sinensis. Gene 2018, 673, 119–129. [Google Scholar] [CrossRef]
  13. Shu, L.; Yang, Y.; Huang, H.; Ye, H. A bone morphogenetic protein ligand and receptors in mud crab: A potential role in the ovarian development. Mol. Cell. Endocrinol. 2016, 434, 99–107. [Google Scholar] [CrossRef] [PubMed]
  14. Yang, Y.; Zhang, P.; Cui, Z.; Bao, C. Bone Morphogenetic Protein 2 Is Involved in Oocyte Maturation Through an Autocrine/Paracrine Pathway in Scylla paramamosain. Front. Mar. Sci. 2021, 8, 748928. [Google Scholar] [CrossRef]
  15. Li, B.-Z.; Lin, C.-Y.; Xu, W.-B.; Zhang, Y.-M.; Shao, Q.-J.; Dong, W.-R.; Shu, M.-A. The first identification and functional analysis of two drosophila mothers against decapentaplegic protein genes (SpSmad1 and SpSmad2/3) and their involvement in the innate immune response in Scylla paramamosain. Fish Shellfish Immunol. 2023, 143, 109183. [Google Scholar] [CrossRef]
  16. Hegarty, S.V.; O’Keeffe, G.W.; Sullivan, A.M. BMP-Smad 1/5/8 signalling in the development of the nervous system. Prog. Neurobiol. 2013, 109, 28–41. [Google Scholar] [CrossRef] [PubMed]
  17. Cannon, J.; Upton, P.; Smith, J.; Morrell, N. Intersegmental vessel formation in zebrafish: Requirement for VEGF but not BMP signalling revealed by selective and non-selective BMP antagonists. Br. J. Pharmacol. 2010, 161, 140–149. [Google Scholar] [CrossRef]
  18. Vollaire, J.; Machuca-Gayet, I.; Bellanger, A.; Josserand, V.; Cohen, P.A. The bone morphogenetic protein signaling inhibitor LDN-193189 enhances metastasis development in mice. Front. Pharmacol. 2019, 10, 437425. [Google Scholar] [CrossRef] [PubMed]
  19. Li, J.; Li, D.-W.; Wang, H.; Hou, X.-L.; Li, L.-H.; Li, L.; Zhang, C.-S. The effect of the bmp inhibitor LDN-193189 on Echinococcus multilocularis protoscoleces. Zhongguo Bingyuan Shengwuxue Zazhi/J. Pathog. Biol. 2021, 16, 429–432. [Google Scholar]
  20. Yadin, D.; Knaus, P.; Mueller, T.D. Structural insights into BMP receptors: Specificity, activation and inhibition. Cytokine Growth Factor Rev. 2016, 27, 13–34. [Google Scholar] [CrossRef]
  21. Kishigami, S.; Mishina, Y. BMP signaling and early embryonic patterning. Cytokine Growth Factor Rev. 2005, 16, 265–278. [Google Scholar] [CrossRef]
  22. Rajagopal, R.; Huang, J.; Dattilo, L.K.; Kaartinen, V.; Mishina, Y.; Deng, C.-X.; Umans, L.; Zwijsen, A.; Roberts, A.B.; Beebe, D.C. The type I BMP receptors, Bmpr1a and Acvr1, activate multiple signaling pathways to regulate lens formation. Dev. Biol. 2009, 335, 305–316. [Google Scholar] [CrossRef] [PubMed]
  23. Sigang, F.; Daizhi, Z.; Baosuo, L.; Zhenghua, D.; Yihui, G.; Dahui, Y. Molecular cloning and expression analysis of BMP7b from Pinctada fucata. South China Fish. Sci. 2018, 14, 121–126. [Google Scholar]
  24. Rosen, V. BMP2 signaling in bone development and repair. Cytokine Growth Factor Rev. 2009, 20, 475–480. [Google Scholar] [CrossRef] [PubMed]
  25. Pan, G.; Gao, X.; Lin, Z.; Yao, H.; Dong, Y. Identification of BMP2 and BMP7 genes and association of their SNPs with growth traits in the hard clam (Meretrix meretrix). Invertebr. Surviv. J. 2019, 16, 141–151. [Google Scholar]
  26. Zhao, M.; Shi, Y.; He, M.; Huang, X.; Wang, Q. PfSMAD4 plays a role in biomineralization and can transduce bone morphogenetic protein-2 signals in the pearl oyster Pinctada fucata. BMC Dev. Biol. 2016, 16, 9. [Google Scholar] [CrossRef]
  27. Morrell, N.W. Pulmonary hypertension due to BMPR2 mutation: A new paradigm for tissue remodeling? Proc. Am. Thorac. Soc. 2006, 3, 680–686. [Google Scholar] [CrossRef] [PubMed]
  28. Retting, K.N.; Song, B.; Yoon, B.S.; Lyons, K.M. BMP canonical Smad signaling through Smad1 and Smad5 is required for endochondral bone formation. Development 2009, 136, 1093–1104. [Google Scholar] [CrossRef]
  29. Klein, M.J.; Ahearn, G.A. Calcium transport mechanisms of crustacean hepatopancreatic mitochondria. J. Exp. Zool. 1999, 283, 147–159. [Google Scholar] [CrossRef]
  30. Lachaise, F.; Le, R.A.; Hubert, M.; Lafont, R. The molting gland of crustaceans: Localization, activity, and endocrine control (A review). J. Crustac. Biol. 1993, 13, 198. [Google Scholar] [CrossRef]
  31. Durica, D.S.; Chung, C.K.; Hopkins, P.M. Characterization of EcR and RXR Gene Homologs and Receptor Expression During the Molt Cycle in the Crab, Uca pugilator. Am. Zool. 1999, 39, 758–773. [Google Scholar] [CrossRef]
  32. Huang, S.; Chen, J.; Chen, X.; Chen, Y.; Yue, W.; Wang, J.; Wang, C. Dynamic analysis of ecdysteroid hormone content and molting related genes expression in the molting cycle of Chinese mitten crab (Eriocheir sinensis). J. Agric. Biotechnol. 2018, 26, 150–158. [Google Scholar]
  33. Li, X.; Xin, J.; Feng, T.; Liu, X. Single nucleotide polymorphism discovery of Molt Inhibiting Hormone gene 3 exons and its association with growth traits in white shrimp (Litopenaeus vannamei). J. Anim. Vet. Adv. 2011, 10, 2856–2858. [Google Scholar]
  34. Bruce, M.J.; Chang, E.S. Demonstration of a molt-inhibiting hormone from the sinus gland of the lobster, Homaru americanus. Comp. Biochem. Physiol. Part A Physiol. 1984, 79, 421–424. [Google Scholar] [CrossRef]
  35. Shyamal, S.; Anilkumar, G.; Bhaskaran, R.; Doss, G.P.; Durica, D.S. Significant fluctuations in ecdysteroid receptor gene (EcR) expression in relation to seasons of molt and reproduction in the grapsid crab, Metopograpsus messor (Brachyura: Decapoda). Gen. Comp. Endocrinol. 2015, 211, 39–51. [Google Scholar] [CrossRef]
Fishes 09 00263 g001
Figure 1. Survival rate (A) and molting rate (B) of S. paramamosain megalopae treated with different concentrations of inhibitors. Different letters indicate significant differences (p < 0.05).
Figure 1. Survival rate (A) and molting rate (B) of S. paramamosain megalopae treated with different concentrations of inhibitors. Different letters indicate significant differences (p < 0.05).
Fishes 09 00263 g001
Fishes 09 00263 g002
Figure 2. Relative expression of ACVR1 in different concentrations of the inhibitor at 6 h, 24 h, 48 h, and 72 h. Different letters indicate significant differences (p < 0.05).
Figure 2. Relative expression of ACVR1 in different concentrations of the inhibitor at 6 h, 24 h, 48 h, and 72 h. Different letters indicate significant differences (p < 0.05).
Fishes 09 00263 g002
Fishes 09 00263 g003
Figure 3. Relative expression of BMP-related genes at different time periods for experimental and control S. paramamosain megalopae: (A) ACVR1; (B) BMPRIB; (C) Smad1. * represents a significant difference (p < 0.05).
Figure 3. Relative expression of BMP-related genes at different time periods for experimental and control S. paramamosain megalopae: (A) ACVR1; (B) BMPRIB; (C) Smad1. * represents a significant difference (p < 0.05).
Fishes 09 00263 g003
Fishes 09 00263 g004
Figure 4. Average weight of experimental and control S. paramamosain. M, C I, C II, C III and C IV represent crablets at stages megalopa, I, II, III and IV. ** represents a highly significant difference (p < 0.01).
Figure 4. Average weight of experimental and control S. paramamosain. M, C I, C II, C III and C IV represent crablets at stages megalopa, I, II, III and IV. ** represents a highly significant difference (p < 0.01).
Fishes 09 00263 g004
Fishes 09 00263 g005
Figure 5. Average molting interval of S. paramamosain. M, C I, C II, and C III represent crablets at stages megalopa, I, II, and III. * represents a significant difference (p < 0.05).
Figure 5. Average molting interval of S. paramamosain. M, C I, C II, and C III represent crablets at stages megalopa, I, II, and III. * represents a significant difference (p < 0.05).
Fishes 09 00263 g005
Fishes 09 00263 g006
Figure 6. Relative expression of BMP-related genes for experimental and control S. paramamosain megalopae at different molt stages: C��intermolt, D—premolt, and AB—postmolt. (A) BMPR2; (B) Smad1; (C) BMP2; (D) BMP7; (E) BMPRIB; (F) ACVR1. Different letters indicate significant differences (p < 0.05).
Figure 6. Relative expression of BMP-related genes for experimental and control S. paramamosain megalopae at different molt stages: C—intermolt, D—premolt, and AB—postmolt. (A) BMPR2; (B) Smad1; (C) BMP2; (D) BMP7; (E) BMPRIB; (F) ACVR1. Different letters indicate significant differences (p < 0.05).
Fishes 09 00263 g006
Fishes 09 00263 g007
Figure 7. Relative expression in the hepatopancreas of genes related to the BMP signaling pathway for experimental and control S. paramamosain megalopae at different molt stages: C—intermolt, D—premolt, and AB—postmolt. (A) BMPR2; (B) BMP2; (C) Smad1. * represents a significant difference (p < 0.05). ** represents a highly significant difference (p < 0.01).
Figure 7. Relative expression in the hepatopancreas of genes related to the BMP signaling pathway for experimental and control S. paramamosain megalopae at different molt stages: C—intermolt, D—premolt, and AB—postmolt. (A) BMPR2; (B) BMP2; (C) Smad1. * represents a significant difference (p < 0.05). ** represents a highly significant difference (p < 0.01).
Fishes 09 00263 g007
Fishes 09 00263 g008
Figure 8. Relative expression of (A) MIH genes and (B) ECR genes in experimental and control S. paramamosain megalopae at different time periods and molt stages. * represents a significant difference (p < 0.05). ** represents a highly significant difference (p < 0.01).
Figure 8. Relative expression of (A) MIH genes and (B) ECR genes in experimental and control S. paramamosain megalopae at different time periods and molt stages. * represents a significant difference (p < 0.05). ** represents a highly significant difference (p < 0.01).
Fishes 09 00263 g008
Table 1. The specific primers used for real-time PCR in this study.
Table 1. The specific primers used for real-time PCR in this study.
Primers NameSequence (5′ to 3′)
MIH-FGCAAGCAGCGGCGAGAGTTAT
MIH-RGCCATTCCTGTGATGCGGTAGAT
EcR-FAGGCTATCACTACAACGCACTCAC
EcR-RGACTCTGGCACAACACATTCTGGT
BMP2-FCAGATGCTGTTCGTCGGTGGATAG
BMP2-RGCTCGCTTGGTTCGCACTTGT
BMP7-FGGTAACGGCTGTGACATCGGAAG
BMP7-RTGGTGGATCGGCGGTAGCATTA
BMPR2-FCTACCAGCAGCAGCCTGTCTGA
BMPR2-RGCCTCCATTCGTTAGAAGCACCTC
ACVR1-FTGTCGCCGTTATGTGTCGAATGG
ACVR1-RGTCCACGCACACCACCTTCTTC
BMPRIB-FTCACGCTGCCACTTGCCTTC
BMPRIB-RAGAGCCTGACGACACCTCCAAT
Smad1-FAAGAGAAGGAGGAGGAGACAGCAAT
Smad1-RTCGGACAAGCATTCGGCATACAC
actin-FCGTGACCTGACTGCCTACCTCA
actin-RGTTGCCGATGGTGATGACCTGAC
Table 2. The weight gain rate and specific growth rate of S. paramamosain.
Table 2. The weight gain rate and specific growth rate of S. paramamosain.
GroupW0 (g)Wt (g)WGR (%)SGR (%/d)
Control0.0049 ± 0.0010.096 ± 0.0121859.67 ± 82.439.91 ± 0.16
Experiment0.0048 ± 0.0010.041 ** ± 0.003736.73 ** ± 39.756.07 ** ± 0.11
W0: average weight of megalopae at the start of cultivation (g); Wt: average weight of crabs at the end of cultivation (g); WGR: specific weight gain rate; SGR: specific growth rate. ** represents a highly significant difference (p < 0.01).
Table 3. Carapace length and carapace width of S. paramamosain juvenile crabs.
Table 3. Carapace length and carapace width of S. paramamosain juvenile crabs.
ItemGroupC IC IIC IIIC IV
FCW (mm)Con326.25 ± 19.9445.03 ± 24.24572.73 ± 27.21704.43 ± 50.8
Exp282.94 * ± 17.23341.16 ** ± 15.44484.23 ** ± 27.19582.5 ** ± 117.38
FCL (mm)Con286.87 ± 12.75374.99 ± 27.13421.37 ± 30.6506.64 ± 48.97
Exp271.8 ± 12.47303.47 ** ± 14.32357.06 ** ± 16.25428.75 ** ± 28.39
C I, C II, C III and C IV represent crablets at stages I, II, III and IV; FCW: full carapace width; FCL: full carapace length; * represents a significant difference (p < 0.05), ** represents a highly significant difference (p < 0.01).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhong, B.; Yu, H.; Han, S.; Song, W.; Ren, Z.; Wang, C.; Mu, C. Functional Study on the BMP Signaling Pathway in the Molting of Scylla paramamosain. Fishes 2024, 9, 263. https://doi.org/10.3390/fishes9070263

AMA Style

Zhong B, Yu H, Han S, Song W, Ren Z, Wang C, Mu C. Functional Study on the BMP Signaling Pathway in the Molting of Scylla paramamosain. Fishes. 2024; 9(7):263. https://doi.org/10.3390/fishes9070263

Chicago/Turabian Style

Zhong, Botao, Huaihua Yu, Shengming Han, Weiwei Song, Zhiming Ren, Chunlin Wang, and Changkao Mu. 2024. "Functional Study on the BMP Signaling Pathway in the Molting of Scylla paramamosain" Fishes 9, no. 7: 263. https://doi.org/10.3390/fishes9070263

Article Metrics

Back to TopTop