Light Intensity Enhances the Lutein Production in Chromochloris zofingiensis Mutant LUT-4
Abstract
:1. Introduction
2. Results and Discussion
2.1. Isolation and Pigment of C. zofingiensis LUT-4 Strain
2.2. Effect of Light Intensity on Growth and Lutein Accumulation of LUT-4
2.3. Effects of Light Intensity on Biochemical Composition
2.4. Carbon Availability Comparison
3. Materials and Methods
3.1. Microalgal Strains and Growth Conditions
3.2. Determination of Dry Weight and Residual Glucose Concentration
3.3. Lutein Content Determination
3.4. Determination of Organic Composition
3.5. Isopentenyl Pyrophosphate (IPP) and Geranylgeranyl Diphosphate (GGPP) Quantification
3.6. Measurement of Ace-CoA and Pyruvate
3.7. Determination of Expression Levels of mRNA
3.8. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Nwachukwu, I.D.; Udenigwe, C.C.; Aluko, R.E. Lutein and Zeaxanthin: Production Technology, Bioavailability, Mechanisms of Action, Visual Function, and Health Claim Status. Trends Food Sci. Technol. 2016, 49, 74–84. [Google Scholar] [CrossRef]
- Lim, L.S.; Mitchell, P.; Seddon, J.M.; Holz, F.G.; Wong, T.Y. Age-Related Macular Degeneration. Lancet 2012, 379, 1728–1738. [Google Scholar] [CrossRef]
- Lin, J.H.; Lee, D.J.; Chang, J.S. Lutein Production from Biomass: Marigold Flowers versus Microalgae. Bioresour. Technol. 2015, 184, 421–428. [Google Scholar] [CrossRef]
- Ho, S.H.; Chan, M.C.; Liu, C.C.; Chen, C.Y.; Lee, W.L.; Lee, D.J.; Chang, J.S. Enhancing Lutein Productivity of an Indigenous Microalga Scenedesmus Obliquus FSP-3 Using Light-Related Strategies. Bioresour. Technol. 2014, 152, 275–282. [Google Scholar] [CrossRef]
- Liu, C.; Hu, B.; Cheng, Y.; Guo, Y.; Yao, W.; Qian, H. Carotenoids from Fungi and Microalgae: A Review on Their Recent Production, Extraction, and Developments. Bioresour. Technol. 2021, 337, 125398. [Google Scholar] [CrossRef]
- Li, D.; Yuan, Y.; Cheng, D.; Zhao, Q. Effect of Light Quality on Growth Rate, Carbohydrate Accumulation, Fatty Acid Profile and Lutein Biosynthesis of Chlorella sp. AE10. Bioresour. Technol. 2019, 291, 121783. [Google Scholar] [CrossRef]
- Shi, X.-M.; Zhang, X.-W.; Chen, F. Heterotrophic Production of Biomass and Lutein by Chlorella protothecoides on Various Nitrogen Sources. Enzyme Microb. Technol. 2000, 27, 312–318. [Google Scholar] [CrossRef]
- Chen, Q.; Chen, Y.; Xiao, L.; Li, Y.; Zou, S.; Han, D. Co-Production of Lutein, Zeaxanthin, and β-Carotene by Utilization of a Mutant of the Green Alga Chromochloris zofingiensis. Algal Res. 2022, 68, 102882. [Google Scholar] [CrossRef]
- Heo, J.; Shin, D.S.; Cho, K.; Cho, D.H.; Lee, Y.J.; Kim, H.S. Indigenous Microalga Parachlorella sp. JD-076 as a Potential Source for Lutein Production: Optimization of Lutein Productivity via Regulation of Light Intensity and Carbon Source. Algal Res. 2018, 33, 1–7. [Google Scholar]
- Gong, M.; Bassi, A. Investigation of Chlorella vulgaris UTEX 265 Cultivation under Light and Low Temperature Stressed Conditions for Lutein Production in Flasks and the Coiled Tree Photo-Bioreactor (CTPBR). Appl. Biochem. Biotechnol. 2017, 183, 652–671. [Google Scholar] [CrossRef]
- Kona, R.; Pallerla, P.; Addipilli, R.; Sripadi, P.; Venkata Mohan, S. Lutein and β-Carotene Biosynthesis in Scenedesmus sp. SVMIICT1 through Differential Light Intensities. Bioresour. Technol. 2021, 341, 125814. [Google Scholar] [CrossRef]
- Chen, Q.; Chen, Y.; Xu, Q.; Jin, H.; Hu, Q.; Han, D. Effective Two-Stage Heterotrophic Cultivation of the Unicellular Green Microalga Chromochloris zofingiensis Enabled Ultrahigh Biomass and Astaxanthin Production. Front. Bioeng. Biotechnol. 2022, 10, 834230. [Google Scholar] [CrossRef]
- Chen, W.C.; Hsu, Y.C.; Chang, J.S.; Ho, S.H.; Wang, L.F.; Wei, Y.H. Enhancing Production of Lutein by a Mixotrophic Cultivation System Using Microalga Scenedesmus obliquus CWL-1. Bioresour. Technol. 2019, 291, 121891. [Google Scholar] [CrossRef]
- Yen, H.W.; Sun, C.H.; Ma, T.W. The Comparison of Lutein Production by Scenesdesmus Sp. in the Autotrophic and the Mixotrophic Cultivation. Appl. Biochem. Biotechnol. 2011, 164, 353–361. [Google Scholar] [CrossRef]
- Chen, C.Y.; Liu, C.C. Optimization of Lutein Production with a Two-Stage Mixotrophic Cultivation System with Chlorella sorokiniana MB-1. Bioresour. Technol. 2018, 262, 74–79. [Google Scholar] [CrossRef]
- Zheng, H.; Wang, Y.; Li, S.; Nagarajan, D.; Varjani, S.; Lee, D.J.; Chang, J.S. Recent Advances in Lutein Production from Microalgae. Renew. Sustain. Energy Rev. 2022, 153, 111795. [Google Scholar] [CrossRef]
- Mao, X.; Zhang, Y.; Wang, X.; Liu, J. Novel Insights into Salinity-Induced Lipogenesis and Carotenogenesis in the Oleaginous Astaxanthin-Producing Alga Chromochloris zofingiensis: A Multi-Omics Study. Biotechnol. Biofuels 2020, 13, 73. [Google Scholar] [CrossRef]
- Roth, M.S.; Westcott, D.J.; Iwai, M.; Niyogi, K.K. Hexokinase Is Necessary for Glucose-Mediated Photosynthesis Repression and Lipid Accumulation in a Green Alga. Commun. Biol. 2019, 2, 347. [Google Scholar] [CrossRef]
- Wu, M.; Zhang, H.; Sun, W.; Li, Y.; Hu, Q.; Zhou, H.; Han, D. Metabolic Plasticity of the Starchless Mutant of Chlorella sorokiniana and Mechanisms Underlying Its Enhanced Lipid Production Revealed by Comparative Metabolomics Analysis. Algal Res. 2019, 42, 101587. [Google Scholar] [CrossRef]
- Oladosu, Y.; Rafii, M.Y.; Abdullah, N.; Hussin, G.; Ramli, A.; Rahim, H.A.; Miah, G.; Usman, M. Principle and Application of Plant Mutagenesis in Crop Improvement: A Review. Biotechnol. Biotechnol. Equip. 2016, 30, 1–16. [Google Scholar] [CrossRef]
- Sánchez, J.F.; Fernández, J.M.; Acién, F.G.; Rueda, A.; Pérez-Parra, J.; Molina, E. Influence of Culture Conditions on the Productivity and Lutein Content of the New Strain Scenedesmus almeriensis. Process Biochem. 2008, 43, 398–405. [Google Scholar] [CrossRef]
- Wei, D.; Chen, F.; Chen, G.; Zhang, X.W.; Liu, L.J.; Zhang, H. Enhanced Production of Lutein in Heterotrophic Chlorella protothecoides by Oxidative Stress. Sci. China C Life Sci. 2008, 51, 1088–1093. [Google Scholar] [CrossRef]
- Ma, R.; Zhang, Z.; Ho, S.H.; Ruan, C.; Li, J.; Xie, Y.; Shi, X.; Liu, L.; Chen, J. Two-Stage Bioprocess for Hyper-Production of Lutein from Microalga Chlorella sorokiniana FZU60: Effects of Temperature, Light Intensity, and Operation Strategies. Algal Res. 2020, 52, 102119. [Google Scholar] [CrossRef]
- Vaquero, I.; Mogedas, B.; Ruiz-Domínguez, M.C.; Vega, J.M.; Vílchez, C. Light-Mediated Lutein Enrichment of an Acid Environment Microalga. Algal Res. 2014, 6, 70–77. [Google Scholar] [CrossRef]
- Del Campo, J.A.; Moreno, J.; Rodríguez, H.; Vargas, M.A.; Rivas, J.; Guerrero, M.G. Carotenoid Content of Chlorophycean Microalgae: Factors Determining Lutein Accumulation in Muriellopsis sp. (Chlorophyta). J. Biotechnol. 2000, 76, 51–59. [Google Scholar] [CrossRef]
- Wu, T.; Yu, L.; Zhang, Y.; Liu, J. Characterization of Fatty Acid Desaturases Reveals Stress-Induced Synthesis of C18 Unsaturated Fatty Acids Enriched in Triacylglycerol in the Oleaginous Alga Chromochloris zofingiensis. Biotechnol. Biofuels 2021, 14, 184. [Google Scholar] [CrossRef]
- Sun, H.; Ren, Y.; Fan, Y.; Lu, X.; Zhao, W.; Chen, F. Systematic Metabolic Tools Reveal Underlying Mechanism of Product Biosynthesis in Chromochloris zofingiensis. Bioresour. Technol. 2021, 337, 125406. [Google Scholar] [CrossRef]
- Sun, H.; Ren, Y.; Lao, Y.; Li, X.; Chen, F. A Novel Fed-Batch Strategy Enhances Lipid and Astaxanthin Productivity without Compromising Biomass of Chromochloris zofingiensis. Bioresour. Technol. 2020, 308, 123306. [Google Scholar] [CrossRef]
- Liang, M.H.; Wang, L.; Wang, Q.; Zhu, J.; Jiang, J.G. High-Value Bioproducts from Microalgae: Strategies and Progress. Crit. Rev. Food Sci. Nutr. 2019, 59, 2423–2441. [Google Scholar] [CrossRef]
- Chen, Z.; Chen, J.; Liu, J.; Li, L.; Qin, S.; Huang, Q. Transcriptomic and Metabolic Analysis of an Astaxanthin-Hyperproducing Haematococcus pluvialis Mutant Obtained by Low-Temperature Plasma (LTP) Mutagenesis under High Light Irradiation. Algal Res. 2020, 45, 101746. [Google Scholar] [CrossRef]
- Sun, H.; Li, X.; Ren, Y.; Zhang, H.; Mao, X.; Lao, Y.; Wang, X.; Chen, F. Boost Carbon Availability and Value in Algal Cell for Economic Deployment of Biomass. Bioresour. Technol. 2020, 300, 122640. [Google Scholar] [CrossRef]
- Jin, H.; Lao, Y.M.; Zhou, J.; Zhang, H.J.; Cai, Z.H. Simultaneous Determination of 13 Carotenoids by a Simple C18 Column-Based Ultra-High-Pressure Liquid Chromatography Method for Carotenoid Profiling in the Astaxanthin-Accumulating Haematococcus pluvialis. J. Chromatogr. A 2017, 1488, 93–103. [Google Scholar] [CrossRef]
- Zhang, Z.; Huang, J.J.; Sun, D.; Lee, Y.; Chen, F. Two-Step Cultivation for Production of Astaxanthin in Chlorella Zofingiensis Using a Patented Energy-Free Rotating Floating Photobioreactor (RFP). Bioresour. Technol. 2017, 224, 515–522. [Google Scholar] [CrossRef]
- Sun, H.; Zhao, W.; Mao, X.; Li, Y.; Wu, T.; Chen, F. High-Value Biomass from Microalgae Production Platforms: Strategies and Progress Based on Carbon Metabolism and Energy Conversion. Biotechnol. Biofuels 2018, 11, 227. [Google Scholar]
- Zhang, H.; Chen, A.; Huang, L.; Zhang, C.; Gao, B. Transcriptomic Analysis Unravels the Modulating Mechanisms of the Biomass and Value-Added Bioproducts Accumulation by Light Spectrum in Eustigmatos Cf. Polyphem (Eustigmatophyceae). Bioresour. Technol. 2021, 338, 125523. [Google Scholar] [CrossRef]
- Varela, J.C.; Pereira, H.; Vila, M.; León, R. Production of Carotenoids by Microalgae: Achievements and Challenges. Photosynth. Res. 2015, 125, 423–436. [Google Scholar] [CrossRef]
- Jin, H.; Chuai, W.; Li, K.; Hou, G.; Wu, M.; Chen, J.; Wang, H.; Jia, J.; Han, D.; Hu, Q. Ultrahigh-Cell-Density Heterotrophic Cultivation of the Unicellular Green Alga Chlorella sorokiniana for Biomass Production. Biotechnol. Bioeng. 2021, 118, 4138–4151. [Google Scholar] [CrossRef]
- Wang, L.; Chen, C.; Tang, Y.; Liu, B. A Novel Hypothermic Strain, Pseudomonas reactans WL20-3 with High Nitrate Removal from Actual Sewage, and Its Synergistic Resistance Mechanism for Efficient Nitrate Removal at 4 °C. Bioresour. Technol. 2023, 385, 129389. [Google Scholar] [CrossRef]
- Lao, Y.M.; Lin, Y.M.; Wang, X.S.; Xu, X.J.; Jin, H. An Improved Method for Sensitive Quantification of Isoprenoi Diphosphates in the Astaxanthin-Accumulating Haematococcus pluvialis. Food Chem. 2022, 375, 131911. [Google Scholar]
Gene | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
PSY | CACCAGGTTGTCAGAGTCCA | ACTAGTGTGTTGCTGACTCT |
PDS | GATGAATGTATTTGCTGAACT | GGCCAGTGCCTTAGCCATAG |
LCYe | TCAAAGCACAGGCGAACAAACA | AACGTCGGGACCTATAAGTCCG |
LCYb | CGCAGGCGAAAAATTCCTGT | TAAGGAATGTCACACCGCTGG |
BKT | GGTGCTCAAAGTGGGGTGGT | CCATTTCCCACATATTGCACCT |
ACT | TGCCGAGCGTGAAATTGTGA | CGTGAATGCCAGCAGCCTCCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Q.; Liu, M.; Mi, W.; Wan, D.; Song, G.; Huang, W.; Bi, Y. Light Intensity Enhances the Lutein Production in Chromochloris zofingiensis Mutant LUT-4. Mar. Drugs 2024, 22, 306. https://doi.org/10.3390/md22070306
Chen Q, Liu M, Mi W, Wan D, Song G, Huang W, Bi Y. Light Intensity Enhances the Lutein Production in Chromochloris zofingiensis Mutant LUT-4. Marine Drugs. 2024; 22(7):306. https://doi.org/10.3390/md22070306
Chicago/Turabian StyleChen, Qiaohong, Mingmeng Liu, Wujuan Mi, Dong Wan, Gaofei Song, Weichao Huang, and Yonghong Bi. 2024. "Light Intensity Enhances the Lutein Production in Chromochloris zofingiensis Mutant LUT-4" Marine Drugs 22, no. 7: 306. https://doi.org/10.3390/md22070306