Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Review
. 2022 Jul 29:11:63.
doi: 10.4103/abr.abr_226_21. eCollection 2022.

The Prominent Role of miR-942 in Carcinogenesis of Tumors

Negar Yadegar  1 , Zahra Dadashi  2 , Kimiya Shams  3 , Mahdis Mohammadi  4 , Mahya Abyar  5 , Milad Rafat  6
Affiliations
Review

The Prominent Role of miR-942 in Carcinogenesis of Tumors

Negar Yadegar et al. Adv Biomed Res. .

Abstract

As a family of short noncoding RNAs, MicroRNAs have been identified as possible biomarkers for cancer discovery and assist in therapy control due to their epigenetic involvement in gene expression and other cellular biological processes. In the present review, the evidence for reaching the clinical effect and the molecular mechanism of miR-942 in various kinds of cancer is amassed. Dysregulation of miR-942 amounts in different kinds of malignancies, as bladder cancer, esophageal squamous cell carcinoma, breast cancer, cervical cancer, gastric cancer, colorectal cancer, Kaposi's sarcoma, melanoma, Hepatocellular carcinoma, nonsmall-cell lung cancer, oral squamous cell carcinoma, osteosarcoma, ovarian cancer, pancreatic ductal adenocarcinoma, renal cell carcinoma, and prostate cancer has stated a considerable increase or decrease in its level indicating its function as oncogene or tumor suppressor. MiR-942 is included in cell proliferation, migration, and invasion through cell cycle pathways, including pathways of transforming growth factor-beta signaling pathways, Wnt pathway, JAK/STAT pathway, PI3K/AKT pathway, apoptosis pathway, hippo signaling pathway, lectin pathway, interferon-gamma signaling, signaling by G-protein coupled receptor, developmental genes, nuclear factor-kappa B pathway, Mesodermal commitment pathway, and T-cell receptor signaling in cancer. An important biomarker, MiR-942 is a potential candidate for prediction in several cancers. The present investigation introduced miR-942 as a prognostic marker for early discovery of tumor progression, metastasis, and development.

Keywords: Biomarker; cancer; miR-942; microRNA; microRNA-942.

PubMed Disclaimer

Conflict of interest statement

There are no conflicts of interest.

Figures

Figure 1
Figure 1
Prediction of Optimal Secondary structure of the has-miR-942 (EPS format) with -56.70 kcal/mol with its dot-bracket notation using the Rfold web server. The sequence of this microRNA: ATTAGGAGAG TATCTTCTCTGTTTTGGCCA TGTGTGT ACTCACAGCC CCTCACACATGGCCGAAACAGAGAAGTTACTTTCCTAAT
Figure 2
Figure 2
The overview of miR-942 contribution in different cellular pathways, which mediated mechanisms involved in cancer progression. Totally, miR-942 working as oncogene to regulate genes such as Apoptosis, which by own have interactions with cell cycle control. In the other side, miR-942 have a hand in controlling the pathways of transforming growth factor-beta signaling pathways, Wnt pathway, JAK/STAT pathway, PI3K/AKT pathway, hippo signaling pathway, lectin pathway, interferon gamma signaling, signaling by GPCR, developmental genes, nuclear factor kappa B pathway, Mesodermal commitment pathway, and T-cell receptor signaling, which targeted by miR-942 and also involved in carcinogenesis, and other pathways which all of them function in cell proliferation and oncogenesis. peroxisome proliferator-activated receptor gamma IκBα
Figure 3
Figure 3
The strategy of search the genes targeted miR-942 in cancers
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

References

    1. Djebali S, Davis CA, Merkel A, Dobin A, Lassmann T, Mortazavi A, et al. Landscape of transcription in human cells. Nature. 2012;489:101–8. - PMC - PubMed
    1. Lee JT. Epigenetic regulation by long noncoding RNAs. Science. 2012;338:1435–9. - PubMed
    1. Zhu S, Li W, Liu J, Chen CH, Liao Q, Xu P, et al. Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library. Nat Biotechnol. 2016;34:1279–86. - PMC - PubMed
    1. Kambara H, Niazi F, Kostadinova L, Moonka DK, Siegel CT, Post AB, et al. Negative regulation of the interferon response by an interferon-induced long non-coding RNA. Nucleic Acids Res. 2014;42:10668–80. - PMC - PubMed
    1. Li Z, Shen J, Chan MT, Wu WK. TUG 1: A pivotal oncogenic long non-coding RNA of human cancers. Cell Prolif. 2016;49:471–5. - PMC - PubMed